| SYS635 |
C. elegans |
ujIs113 II; ceh-28(dev192([mNeonGreen::ceh-28]) X. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of ceh-28 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
| SYS636 |
C. elegans |
ujIs113 II; ceh-23(dev193([mNeonGreen::ceh-23]) III. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of ceh-23 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
| SYS637 |
C. elegans |
ujIs113 II; egl-46(dev194([mNeonGreen::egl-46]) V. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of egl-46 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
| SYS638 |
C. elegans |
ujIs113 II; lin-48(dev195([mNeonGreen::lin-48]) III. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of lin-48 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
| SYS639 |
C. elegans |
ujIs113 II; svh-5(dev196([svh-5::mNeonGreen]) X. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of svh-5 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
| SYS641 |
C. elegans |
ujIs113 II; hbl-1(dev198([hbl-1::mNeonGreen]) X. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of hbl-1 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
| SYS642 |
C. elegans |
ujIs113 II; egl-13(dev199([egl-13::mNeonGreen]) X. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of egl-13 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
| SYS643 |
C. elegans |
ujIs113 II; ets-5(dev200([ets-5::mNeonGreen]) X. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of ets-5 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
| SYS644 |
C. elegans |
ujIs113 II; ttx-1(dev201([ttx-1::mNeonGreen]) V. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of ttx-1 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
| SYS645 |
C. elegans |
ujIs113 II; lin-1(dev202([lin-1::mNeonGreen]) IV. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of lin-1 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
| SYS667 |
C. elegans |
rcor-1(dev232([rcor-1::mNeonGreen]) I; ujIs113 II. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of rcor-1 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
| SYS668 |
C. elegans |
let-381(dev205([mNeonGreen::let-381]) I; ujIs113 II. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of let-381 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
| SYS671 |
C. elegans |
ujIs113 II; lag-1(dev208([lag-1::mNeonGreen]) IV. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of lag-1 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
| SYS672 |
C. elegans |
ujIs113 II; ceh-44(dev209([mNeonGreen::ceh-44]) III. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of ceh-44 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
| SYS673 |
C. elegans |
ujIs113 II; egl-18(dev210([egl-18::mNeonGreen]) IV. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of egl-18 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
| SYS675 |
C. elegans |
ujIs113 II; ceh-60(dev212([mNeonGreen::ceh-60]) X. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of ceh-60 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
| SYS676 |
C. elegans |
ujIs113 II; hnd-1(dev213([mNeonGreen::hnd-1]) X. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of hnd-1 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
| SYS677 |
C. elegans |
ujIs113 II; baz-2(dev214([mNeonGreen::baz-2]) III. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of baz-2 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
| SYS678 |
C. elegans |
nfyc-1(dev215([nfyc-1::mNeonGreen]) ujIs113 II. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of nfyc-1 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
| SYS679 |
C. elegans |
ujIs113 II; arid-1(dev216([arid-1::mNeonGreen]) V. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of arid-1 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
| SYS680 |
C. elegans |
ujIs113 II; elt-1(dev217([elt-1::mNeonGreen]) IV. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of elt-1 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
| SYS681 |
C. elegans |
unc-37(dev218([mNeonGreen::unc-37]) I; ujIs113 II. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of unc-37 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
| SYS683 |
C. elegans |
lin-31(dev220([mNeonGreen::lin-31]) ujIs113 II. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of lin-31 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
| SYS696 |
C. elegans |
nhr-49(dev169([nhr-49::mNeonGreen]) I; ujIs113 II. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of nhr-49 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
| SYS714 |
C. elegans |
Y73E7A.1(dev233([Y73E7A.1::mNeonGreen]) I; ujIs113 II. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of Y73E7A.1 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
| SYS724 |
C. elegans |
ujIs113 II; nob-1(dev231([mNeonGreen::nob-1]) III. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of nob-1 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
| SYS744 |
C. elegans |
ujIs113 II; ceh-30(dev253([mNeonGreen::ceh-30]) X. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of ceh-30 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
| SYS80 |
C. elegans |
ujIs113 II; Y75B8A.6(dev31([gfp::Y75B8A.6]) III. Show Description
GFP knockin at N-terminus of Y75B8A.6 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
| SYS81 |
C. elegans |
ujIs113 II; skn-1(hq82([skn-1::gfp]) IV. Show Description
GFP knockin at C-terminus of skn-1 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
| SYS867 |
C. elegans |
ujIs113 II; ceh-31(dev250([mNeonGreen::ceh-31]) X. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of ceh-31 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
| SZ155 |
C. elegans |
unc-73(e936) I; prp-8(az29) III. Show Description
prp-8(az29) is a G654E missense mutation. az29 is a CRISPR-induced mutation mimicking a known suppressor of unc-73(e936). It changes cryptic splicing of e936 to allow for an increase in full-length unc-73 expression. Reference: Mayerle M, et al. Proc Natl Acad Sci U S A. 2019 Feb 5;116(6):2193-2199. doi: 10.1073/pnas.1819020116. PMID: 30674666.
|
|
| SZ197 |
C. elegans |
unc-73(e936) I; prp-8(az50) III. Show Description
prp-8(az50) is a T524S missense allele that affects cryptic splicing (5'ss choice) of unc-73(e936) to allow more UNC-73 protein to be produced. PRP-8 is the largest protein in the spliceosome (essential) with a role in all stages of splicing. Reference: Mayerle M, et al. Proc Natl Acad Sci U S A. 2019 Feb 5;116(6):2193-2199. doi: 10.1073/pnas.1819020116. PMID: 30674666.
|
|
| SZ340 |
C. elegans |
smg-4(az152) V. Show Description
CRISPR/Cas9 engineered smg-4 null allele. smg-4(az152) allele is confirmed NMD-defective by both the presence of the protruding vulva phenotype and the accumulation of NMD-targeted isoforms. smg-4(az152) is easy to track in crosses by PCR and digestion with BstBI (see S1 text of Suzuki, et al. for sequence of allele) and essentially mimics ma116 in having a G->A mutation at the last base of intron 1. az152 also removes two bases of exon 2 and inserts 50nt in exon 2. Reference: Suzuki JMNGL, et al. PLoS Genet. 2022 Feb 10;18(2):e1010028. doi: 10.1371/journal.pgen.1010028. PMID: 35143478.
|
|
| TG12 |
C. elegans |
cep-1(lg12501) I; unc-119(ed4) III; gtIs1. Show Description
gtIs1[CEP-1::GFP + unc-119(+)]. GFP expression in germ line of adult worms (20-40 hours post L4) in the late pacytene area in the nucleus. Also expression in alae and a few nuclei in the pharynx. Compound microscope needed to see staining.
|
|
| TG1749 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; gtIs60. Show Description
gtIs60 [pie-1p::GFP(lap)::orc-1 + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Reference: Sonneville R, et al. J Cell Biol. 2012 Jan 23;196(2):233-46.
|
|
| TG1750 |
C. elegans |
unc-119(ed3) III; ltIs37 IV, gtIs61. Show Description
gtIs61 [pie-1p::GFP(lap)::orc-2 + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Reference: Sonneville R, et al. J Cell Biol. 2012 Jan 23;196(2):233-46.
|
|
| TG1751 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; gtIs62. Show Description
gtIs62 [pie-1p::GFP(lap)::cdc-6 + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Reference: Sonneville R, et al. J Cell Biol. 2012 Jan 23;196(2):233-46.
|
|
| TG1752 |
C. elegans |
unc-119(ed3) III; gtIs63. Show Description
gtIs63 [pie-1p::GFP(lap)::mcm-2 + unc-119(+)]. Reference: Sonneville R, et al. J Cell Biol. 2012 Jan 23;196(2):233-46.
|
|
| TG1753 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; gtIs64. Show Description
gtIs64 [pie-1p::GFP(lap)::mcm-3 + unc-119(+)]. ltIs37 [(pie-1p::mCherry::his-58 + unc-119(+)] IV. Reference: Sonneville R, et al. J Cell Biol. 2012 Jan 23;196(2):233-46.
|
|
| TG1754 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; gtIs65. Show Description
gtIs65 [pie-1p::GFP(lap)::cdc-45 + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Reference: Sonneville R, et al. J Cell Biol. 2012 Jan 23;196(2):233-46.
|
|
| TG1755 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; gtIs66. Show Description
gtIs66 [pie-1p::GFP(lap)::div-1 + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Reference: Sonneville R, et al. J Cell Biol. 2012 Jan 23;196(2):233-46.
|
|
| TG1756 |
C. elegans |
unc-119(ed3) III; ltIs37 IV. gtIs67. Show Description
gtIs67 [pie-1p::GFP(lap)::sld-5 + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Reference: Sonneville R, et al. J Cell Biol. 2012 Jan 23;196(2):233-46.
|
|
| TG1890 |
C. elegans |
mus-81(tm1937) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); xpf-1(tm2842) II. Show Description
Segregates WT GFP+ heterozygotes, non-GFP mus-81; xpf-1 double homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+ to retain balanced strain: 15-25% of mus-81; xpf-1 double homozygotes are viable. unc-119(ed3) has likely been lost through outcrossing, but could still be present in the background. Reference: Agostinho A, et al. PLos Genetics 2013.
|
|
| TG2367 |
C. elegans |
unc-119(ed3) III; gtIs2367/+. Show Description
gtIs2367 [pie-1p::GFP(lap)::orc-5 + unc-119(+)]. Maintain by picking non-Unc. Reference: Sonneville R, et al. J Cell Biol. 2012 Jan 23;196(2):233-46.
|
|
| TG2368 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; gtIs2368. Show Description
gtIs2368 [pie-1p::GFP(lap)::rpa-1 + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Reference: Sonneville R, et al. J Cell Biol. 2012 Jan 23;196(2):233-46.
|
|
| TG2394 |
C. elegans |
cat-2(e1112) II; vtIs1 V; tsp-17(gt1681) X. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.
|
|
| TG3867 |
C. elegans |
xpg-1(tm1670) I. Show Description
Superficially wild-type. Deletion site verified by PCR. Reference: Meier B, et al. 2020 bioRxiv, https://doi.org/10.1101/2020.06.04.133306
|
|
| TG4094 |
C. elegans |
unc-119(ed3) III; cxTi10816 IV; otIs433 V; gtEx4094. Show Description
otIs433 [dat-1::NLS::RFP + ttx-3::mCherry] V. gtEx4094 [glit-1p::GFP::glit-1 3'UTR + myo-3p::mCherry]. Pick animals with red fluorescence in body muscles to maintain. Transcriptional glit-1 reporter. Reference: Offenburger SL, et al. https://www.biorxiv.org/content/early/2017/10/13/203067.
|
|
| TG4281 |
C. elegans |
unc-119(ed3) III; cxTi10816 IV; gtEx4170. Show Description
gtEx4170 [ttr-33p::GFP::ttr-33 3'UTR + myo-2p::mCherry + myo-3p::mCherry]. Pick mCherry+ animals to maintain. Transcriptional ttr-33 reporter. Reference: Offenburger SL, et al. https://www.biorxiv.org/content/early/2017/10/13/198606.
|
|
| TH112 |
C. elegans |
let-99(dd17) IV/nT1 [qIs51] (IV;V). Show Description
let-99(dd17) contains a 647bp deletion with the flanking sequences aatttttaggaagtttccagaaatttttcc / CAAGGCTCCCACGAAGATTATCGCGATCTA. The deletion removes the N terminus of the open reading frame including the start codon and the DEP domain. Heterozygotes are GFP+ in the pharynx. dd17 is a maternal effect lethal mutation.
|
|