| RG3469 |
C. elegans |
C31H5.6(ve969[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 3336 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GGTTTTAATGGTGCATTAACAATGAAAAGA ; Right flanking sequence: tggtttttttataaacatttgtcacagtta. C31H5.6 crRNA A: CGAGTCCAATCAGGCATTGG; C31H5.6 crRNA B: aattcattgtaaggctaggg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3470 |
C. elegans |
hap-1(ve970[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 963 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tatatttgatattattcgaacgcgaaattt ; Right flanking sequence: tggattttaaccttcctacaaaagaatatt. hap-1 sgRNA A: tgcgccaaaagtacgatgcc; hap-1 sgRNA B: tatgagaaaagagtaatttc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3471 |
C. elegans |
cls-3(ve971[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 4049 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCTCAAACAATCTTCCACAGCAAGAGCCG ; Right flanking sequence: TCCCGGCCACAAATTTTGGCGGGAAATTCA. cls-3 crRNA A: AAATACGAACGACGCAACAA; cls-3 crRNA B: AAAACGACACCTCTCAGCCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3472 |
C. elegans |
rpc-1(ve972[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Larval arrest. Deletion of 3929 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested early larvae (ve972 homozygotes, rare escapers are fertile adults), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GTCTTTCCATGAGCAACAATTTTACATCCT; Right flanking sequence: CGGCTTTTTTTACGGTTCctgaatacaaaa. rpc-1 crRNA A: AAAGTGTGTCCACAGATGAG; rpc-1 crRNA B: AATCTTCAGAACTGCTCCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3473 |
C. elegans |
cls-1(ve973[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 7096 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCTATAAATGTATGACTCACACTTTTTCCG ; Right flanking sequence: TGGGCCGCGCCAAGTCATCCGAATCAGGAG. cls-1 crRNA A: AGAGAAAACCCCCGTTGTTT; cls-1 crRNA B: GAACCTAATTGACCTGTACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3474 |
C. elegans |
nhr-172(ve974[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1250 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCCTGTGAAGCATGTAAAATGTTCTTCCG ; Right flanking sequence: GGGTTTCGCGCTAAAACTCTTGTTTCCGAT. nhr-172 sgRNA A: GGTTTTCGACTATTGCTCGA; nhr-172 sgRNA B: TGTTACAAACTTTTGTCCCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3475 |
C. elegans |
eif-2Bbeta(ve975[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hIn1 [umnIs78] I. Show Description
umnIs78 [myo-2p::mKate2 + NeoR, I: 12541645 (intergenic)] I. Larval arrest. Deletion of 1777 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve975 homozygotes), and viable non-GFP mKate2+ animals (hIn1[umnIs78] homozygotes). Maintain by picking wild-type GFP+mKate2+. Left flanking Sequence: acgaaaaaagacccagaaaaaatggagaaa; Right flanking sequence: ATATTAATAATAATGAGCTCCGATCGCTCG. eif-2Bbeta crRNA A: aaCGGGGGGTACAAGTTATG; eif-2Bbeta crRNA B: CGGCTTAATGATCACGAAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3476 |
C. elegans |
+/nT1 [umnIs49] IV; mcm-7(ve976[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Larval lethal. Deletion of 1803 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead translucent early larvae (ve976 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GTCTTCATATGGATAGGAACGAGGGAGCCG; Right flanking sequence: ATTCAAAGATGCGCTCGCAAGGGAATCAGC. mcm-7 sgRNA A: AAGAGAAACTTCCTCGTTGG; mcm-7 sgRNA B: GGCGTTTGAGATGGCGATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3477 |
C. elegans |
his-68(ve977[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 474 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gattagttttacgatcaccaatcgctcata ; Right flanking sequence: tatttgtgctatatttttcatttcttattc. his-68 sgRNA A: ATGTCTGGGCGTGGAAAGGG; his-68 sgRNA B: gtttattgatttgaacaaag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3478 |
C. elegans |
let-805(ve978[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)] III. Emb. Deletion of 22058 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), dead embryos (ve978 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: aggtagaaaaaatgtagactagccccccct; Right flanking sequence: tcgttttccaaattaatcagaaattagcat. let-805 sgRNA #1: tgagtcagcagaggccgggg; let-805 sgRNA B: attacGTTGGGTTGCAGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3479 |
C. elegans |
rpl-15(ve979[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/dpy-9(tm9713) kvs-5(tmIs1245) IV. Show Description
tmIs1245 Break points: dpy-9 kvs-5 IV. Covered region (Mb) (0.3..0.7) Balancer marked with myo-2p::Venus. Larval arrest. Deletion of 879 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ Venus+, and segregate wild-type GFP+Venus+, GFP+ arrested early larvae (ve979 homozygotes), and Venus+ dpy-9 (dpy-9(tm9713) kvs-5(tmIs1245) homozygotes). Pick WT bright GFP and check for correct segregation of progeny to maintain. [NOTE: ve979 deletion also removes K11H12.12 and K11H12.13, each of which encodes a snoRNA.] Left flanking Sequence: GAAAACTTTGGTGTTCTTTCTCTTCCAGTT; Right flanking sequence: TGGACGGCGCTCAACTGTCTGTAGTGCCAG. rpl-15 crRNA A: CTTGGCTTGGGATCCTCCGC; rpl-15 crRNA B: TGGTTGGGCGTGGGACACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3480 |
C. elegans |
col-123(ve980[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 1079 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. The indel of col-123 resides within an intron of catp-6. It is not known if ve980 affects catp-6 expression or function. Left flanking Sequence: ggaaatgatgggaatattttcagagttcct ; Right flanking sequence: AGGTGGAGGCGGCGGAGGCGGAGAATACAA. col-123 sgRNA A: ATGACACTTGCATtctatac; col-123 sgRNA B: TCTCATGGTGGTTCATCTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3481 |
C. elegans |
ech-9(ve981[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 2053 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: caatttaacaaaaactgtttcaaaaaacca ; Right flanking sequence: atttgtaatatatcacgtttttactgccca. ech-9 sgRNA A: gtctgtcccgtcttttataa; ech-9 sgRNA B: gaaaagtacctataaaaggg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3482 |
C. elegans |
+/mT1 [umnIs52] II; copd-1(ve982[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Embryonic lethal. Deletion of 1942 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, dead embryos (ve982 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: AATGTGTACTCAATATTGACTTGGACTCCA; Right flanking sequence: CATGAGCAGGAAAAACTTTTTTGGCAGGCA. copd-1 crRNA A: TGGCCTCAAGAATCATCTGA; copd-1 crRNA B: GCCTAAAACTACCCTTTTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3483 |
C. elegans |
egrh-3(ve983[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 8336 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAAGCTTGTGATGCTCCACCACCAGCTCCA ; Right flanking sequence: tggcctagaaaaaagttaggccaccaataa. egrh-3 crRNA A: ACGACATTTAAGCTTCAGGG; egrh-3 crRNA B: CACGCGattttctgatacgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3484 |
C. elegans |
+/mT1 [umnIs52] II; eftu-2(ve984[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Larval arrest. Deletion of 2360 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve984 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Note: some, but not all balanced heterozygotes display vulva phenotypes such as blips, explode at vulva, and/or egl. Left flanking Sequence: TGTTCTTCATGAAGATAAAAAGTACTATGC; Right flanking sequence: TGGAGGTCAGATGATCCCAACTGCACGCCG. eftu-2 sgRNA #1: TACAGCTCTCGAAGTATACG; eftu-2 sgRNA #2: ACAGAACCACTTTATCGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3485 |
C. elegans |
+/mT1 [umnIs52] II; rpl-21(ve985[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Larval arrest. Deletion of 489 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve985 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: CACGGTTCAAGAAGTCGGTTCTGCACTTGG; Right flanking sequence: aggaacaaaaatgtaaaacaatttgccgag. rpl-21 crRNA A: ATGGCTTGATGTGCTCGATA; rpl-21 crRNA B: tgtcaatatagagaactacg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3486 |
C. elegans |
rps-15A(ve986[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC1(s2023) [dpy-1(s2170) umnIs41] III. Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Early larval arrest. Deletion of 598 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve986 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Other names: CELE_F53A3.3, uS8, rps-22. Left flanking Sequence: ATGAACGTCCTCGCCGATGCGCTCAACGCC; Right flanking sequence: CACGAGGAGGCCAGAAGAAAGCATTTGGGA. rps-22 crRNA A: ATCAACAACGCCGAGAAGCG; rps-22 crRNA B: ATCCATGATTCCGGCGGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3487 |
C. elegans |
dhs-20(ve987[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1097 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTTTTGGGATATTATTTTTAAAAAACCCT ; Right flanking sequence: ATTGATAAGGTTTTTTTGTTCTTGATTCTT. dhs-20 sgRNA A: GAGATTGTTAAAGGGTGTCC ; dhs-20 sgRNA B: TGGGTCGACCTTGAACACGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3488 |
C. elegans |
rps-26(ve988[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hIn1 [umnIs78] I. Show Description
umnIs78 [myo-2p::mKate2 + NeoR, I: 12541645 (intergenic)] I. Early larval arrest. Deletion of 598 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve988 homozygotes), and viable non-GFP mKate2+ animals (hIn1[umnIs78] homozygotes). Maintain by picking wild-type GFP+mKate2+. Left flanking Sequence: ggtacaATGACGTTCAAGAGACGTAACCAC; Right flanking sequence: tttgaaattataaacctttttgttgcaatc. rps-26 crRNA A: GGAAGAAACAAGAAGAACCG; rps-26 crRNA B: gaacaaacaacTTATGGACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3489 |
C. elegans |
rps-17(ve989[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Sterile. Deletion of 459 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ heterozygotes, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 ve989 homozygotes (most are inviable, some reach adulthood and are sickly, sterile with a protruding vulva, some may produce a small brood), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: acttacAGCGGCCTTGAGCATGTCGCTGGT; Right flanking sequence: aggtcgaatgagaaaaaaattaattgatat. rps-17 crRNA A: ATCAGTGTCAACCTTGATGG; rps-17 crRNA B: gcgcaacgtaatagatgaac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3490 |
C. elegans |
Y42A5A.5(ve990[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 2367 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gcgaatttgtgaaatttgggaagagcatga ; Right flanking sequence: cggtttttaaaatacttatgaaatgtagtt. Y42A5A.5 crRNA A: atcaatatgccggagatcgt; Y42A5A.5 crRNA B: GAGTAGGcacaggtgtttcg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3491 |
C. elegans |
rps-24(ve991[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV/dpy-9(tm9713) kvs-5(tmIs1245) IV. Show Description
tmIs1245 Break points: dpy-9 kvs-5 IV. Covered region (Mb) (0.3..0.7) Balancer marked with myo-2p::Venus. Larval arrest. Deletion of 402 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ Venus+, and segregate wild-type GFP+Venus+, GFP+ arrested larvae (ve991 homozygotes),Venus+ dpy-9 (dpy-9(tm9713) kvs-5(tmIs1245) homozygotes). Pick WT bright GFP and check for correct segregation of progeny to maintain . Left flanking Sequence: aattttaaaactacaattcaaatttatttt; Right flanking sequence: AGACTCGTTCGCgtaagttacttttctgaa. rps-24 crRNA A: gcaggtaatattcatcacgA; rps-24 crRNA B: GTACTTCGGCTCAAACTTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3492 |
C. elegans |
rps-29(ve992[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC1(s2023) [dpy-1(s2170) umnIs41] III. Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Larval arrest. Deletion of 754 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve992 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: caccgtcttcttgttttccgcttttttcct; Right flanking sequence: gttaacttcatgtcttcaatcaataaattg. rps-29 crRNA A: ttcgaaaaagctgtaaacgg; rps-29 crRNA B: aataacaagatttgacgagg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3493 |
C. elegans |
rars-1(ve993[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)] III. Larval arrest. Deletion of 2015 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) arrested larvae (ve993 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Note: this strain exhibits ectopic body wall GFP expression. Left flanking Sequence: aaggctcgacatgtaattacacacatacCT; Right flanking sequence: AGGGGAACATCAAGTCCAGGGAATGCATCT. rars-1 crRNA A: GTTATTGAAAATAAGGAAGG; rars-1 crRNA B: TTGGAGTTTCAGCGAGGAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3494 |
C. elegans |
+/mT1 [umnIs52] II; pars-1(ve994[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Larval lethal. Deletion of 1632 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead larvae (ve994 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: AGAGATCGAGGAGCAAGGAGCCGAAGTCCG; Right flanking sequence: TCAAATCTCTTCTTGATGAAATTCATACTG. pars-1 crRNA A: TCTTGTCACCTTTCACACGG; pars-1 crRNA B: CAGTTTTAGACAGTCCTTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3495 |
C. elegans |
K02D10.4(ve995[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 1717 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgcgctccattggcaaatgaaaacgctccg ; Right flanking sequence: TGGAATTATAAGCAATTTTTCAAAAATCTA. K02D10.4 sgRNA A: cgagaccgaactgttgaggg; K02D10.4 sgRNA B: ATGATGAACACGATGACATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3496 |
C. elegans |
Y25C1A.8(ve996[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 3675 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CACTTTCTGGGCAAGAGCATTCACCGCCCG ; Right flanking sequence: CGGTTTCGCTGAAAATCGATAATTTTTGGG. Y25C1A.8 sgRNA A: CAGATGCTCATGCTCATGCT; Y25C1A.8 sgRNA B: CCAATTTTGCTTTTCGCGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3497 |
C. elegans |
ZK1010.10(ve997[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 2442 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATCTAGATTCCACTATAGTTATCCTGGAAA ; Right flanking sequence: GATCTCGACCACTTGGTGCATCGAGTCGTC. ZK1010.10 sgRNA A: CCTAGGAATTCATGACATTg; ZK1010.10 sgRNA B: GTAGAGATGGTAGGATCCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3498 |
C. elegans |
ZK1240.5(ve998[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1535 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GGCGCTGATATTTTGAAGCGCACAAAAACC ; Right flanking sequence: GCAAAATGGGCATACAATTCTGCCGTTGTT. ZK1240.5 sgRNA A: GAATGTGCACATAGAAAGTC; ZK1240.5 sgRNA B: CGCGAACCAACTGAGATACC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3499 |
C. elegans |
ZK1240.6(ve999[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 398 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCCTGAAAATTAATATTAGGTACCTGACCT ; Right flanking sequence: ACTTGGAAATTGGAGAGCAAGTAAAAGTTA. ZK1240.6 sgRNA A: ACTTCAGAACCTGATATGCA; ZK1240.6 sgRNA B: TAGTCGAGTTATTCGTGCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3500 |
C. elegans |
nhr-146(ve1000[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 3445 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGATCGATTTGCTGTTTGACTTTTTTCCG ; Right flanking sequence: AGGCGTACGCTGTGGATGAGAAATTCTATG. nhr-146 crRNA A: CATTTTAAAAGTGCAACGGC; nhr-146 crRNA B: TGAGCTGAGCCATGTGATGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3501 |
C. elegans |
F58G1.2(ve1001[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [umnIs52] II; +/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Sterile. Deletion of 3478 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile adults (ve1001 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: TATTGTAAACATTAAAATGTGGGAAAACTG; Right flanking sequence: TCCTGATTGTTCCTGTAATTAATTGCATTA. F58G1.2 crRNA A: GGTGAAATCGTCATTGAACG; F58G1.2 crRNA B: CAAGCAACGAGAAACAATGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3502 |
C. elegans |
madf-11(ve1002[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)] III. Mel. Deletion of 2623 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) adults that give progeny that die early (ve1002 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: AAAGTTAAATATTGATGTTGAAGTTTGCCT; Right flanking sequence: ATTTTTAATAATAATTCTGAAATTTATTTT. madf-11 crRNA A: GTTCCCATTGAAAAATCACC; madf-11 crRNA B: TTCCAATGAGCGACCGACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3503 |
C. elegans |
ears-1(ve1003[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Larval arrest. Deletion of 3574 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve1003 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: TGATGCTGTCACGAAGAATGACTATTCCCT; Right flanking sequence: GGGGATACACTTTCCAAGCAGATTGATGAT. ears-1 crRNA A: GAAAATCCTTTCCCAAAAGG; ears-1 crRNA B: CAGCTCCATCGGTCTCCGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3504 |
C. elegans |
gars-1(ve1004[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)] III. Larval arrest. Deletion of 1643 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) arrested larvae (ve1004 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: TGTAACTCATCTCAAAGCGTGAGAGTTCCT; Right flanking sequence: ATCATAGAAGAATCGTCTTTTGAGAAGATC. gars-1 crRNA A: AGTTATGGATGCCGTTAAGG; gars-1 crRNA B: CAATCATTTGCTATCTATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3505 |
C. elegans |
tsr-1(ve1005[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC6 [dpy-2(tmIs1208)] II. Show Description
tmIs1208 [myo-2p::mCherry, II: dpy-2] II. Sterile. Deletion of 7616 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, GFP+ non-mCherry sterile adults (ve1005 homozygotes) and Dpy non-GFP mCherry+ (tmC6 homozygotes). Maintain by picking wild-type GFP+ mCherry+. Note: tsr-1 is near ZK1240.1, the gene marking the breakpoint of the tmC6 balancer. Left flanking Sequence: aaatTTAGATGAACAGCTTGGCGAGATCAC; Right flanking sequence: tagtgagctctagttttcggtgtctaggct. tsr-1 crRNA A: GAGTATGGTTGAAGACGGCG; tsr-1 crRNA B: gctcaattttgaagtctcgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3506 |
C. elegans |
+/nT1 [umnIs49] IV; sqv-4(ve1006[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Sterile. Deletion of 1511 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sterile adults (ve1006 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GATCGTAGACTGATAATTTTGCATGCTCCT; Right flanking sequence: tacaatgcagaatatgcacaataaatgacg. sqv-4 crRNA A: CGTAATCAAACACTTGATGG; sqv-4 crRNA B: cgagttgattttctgtaggg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3507 |
C. elegans |
orai-1(ve1007[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC1(s2023) [dpy-1(s2170) umnIs41] III. Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Homozygous sterile. Deletion of 7387 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile GFP+ non-mKate2 (ve1007 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. orai-1 is near unc-45 and therefore near the outer limit of the sC1 balancer. Left flanking Sequence: ATCCTGACGTCAGAGATCTTCTGAAATCCG; Right flanking sequence: GTGTTCCGTCATGCCATTTTAATCTGTGTG. orai-1 crRNA A: CTTTCGAAGTCTCCGTTTCG; orai-1 crRNA B: GTGGCGAGACAGTGAGCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3508 |
C. elegans |
F58F9.1 & T13A10.2(ve1008[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 3800 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCCATTTTCTGAAGAAGAAATCACTCATTC ; Right flanking sequence: AGGGAAATTTCGAGCCGCCACAATGGTGAA. F58F9.1_T13A10.2 crRNA A: TGCCTTCTTCGACTGCTTGG; F58F9.1_T13A10.2 crRNA B: CTTATTGTGGCGCGTGCATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3509 |
C. elegans |
rps-19(ve1009[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Larval arrest. Deletion of 653 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larva (ve1009 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: aacacaaacaacgagtgtTTAGGCTTGTTG; Right flanking sequence: ATGGAGGTCGCTCTCGTCATtttacctgaa. rps-19 crRNA A: TCCAGAGGATCTGAGGCTGG; rps-19 crRNA B: CAAGGACGTCGACCAGCACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3510 |
C. elegans |
+/nT1 [umnIs49] IV; rps-27(ve1010[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Larval arrest. Deletion of 748 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larva (ve1010 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ttacgacccccgttttcaccctcattacca; Right flanking sequence: GGGTGAAGAAGGTCAACGGCCAAAGGCATt. rps-27 crRNA A: atcattggctgtctcgtctc; rps-27 crRNA B: TGATCTCCCTTTGTGGCTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3511 |
C. elegans |
sars-1(ve1011[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Early larval arrest. Deletion of 1278 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larva (ve1011 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: caatcattaaaaacattgccaacagttgaa; Right flanking sequence: AGgtatatataaaacttattatactaaacg. sars-1 crRNA A: aaacagtatcgaagttaagG; sars-1 crRNA B: GACCAAGAAACTGAGTGGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3512 |
C. elegans |
twk-39(ve1012[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 6547 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttcccccaaaaagttttgtttcgtatccca ; Right flanking sequence: TGGGAGAATTGGAATGGATTTGATGGTGCC. twk-39 crRNA A: ctgatcgaacctaaagatgg; twk-39 crRNA B: GAGCTTGGCTGTTCTCCTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3513 |
C. elegans |
glct-5(ve1013[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1213 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATTGAAAATTGGCTAACCGATACACGCCT ; Right flanking sequence: AGGCTTTGCGATCAACCTGAAATACATCCT. glct-5 crRNA A: TTCTGAAGATCGCAAAGTGC; glct-5 crRNA B: CGATTTGCAGTAGACATGGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3514 |
C. elegans |
K10C3.5(ve1014[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Maternal effect lethal. Deletion of 5068 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 adults that lay dead eggs (ve1014 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: TTTGCTCTGTGAGCCACTTCTCATCAATCT; Right flanking sequence: TGGTGTCAACGACCTGATGGGTATAGCGTA. K10C3.5 crRNA A: CATTGATAGTCCGGGACACG; K10C3.5 crRNA B: ACTGTTTCATTCACGTGTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3515 |
C. elegans |
yars-2(ve1015[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Larval arrest. Deletion of 1304 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve1015 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: CATCGCCACTTCTAAACCTTCTTTTCCGTG; Right flanking sequence: tggtcggagaaaatcctcggccacccggcc. yars-2 crRNA A: CACAATTCGAGTAATTTCGG; yars-2 crRNA B: ttccacaaaactccgcgcgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3516 |
C. elegans |
C55A6.10(ve1016[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 2047 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GGATCAGTTGTCAAAGCAGTGCGAGAAGCT ; Right flanking sequence: TTAACGCACGTTGTTTGTACAGTCCAAGAG. C55A6.10 crRNA A: TGTTGCAGAAACTGGAGACC; C55A6.10 crRNA B: AAAAATGCGGAAAAATCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3517 |
C. elegans |
slc-25A26(ve1017[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Late larval arrest. Deletion of 1778 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 thin slow moving larvae (ve1017 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ATTTTAAATATGGAGTAATTTAGGATGCCA; Right flanking sequence: CGGTGGTTTTGTTTTCTTCGGTGCCTATGA. slc-25A26 crRNA A: ACCACCGATCCTTCTTCTGA; slc-25A26 crRNA B: CGTGTAATGTGGATTTCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3518 |
C. elegans |
+/mT1 [umnIs52] II; D2045.9(ve1018[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Emb. Deletion of 3962 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead embryos (ve1018 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: ATAGACTACTATTTGAAGGCTAACTTTCCA; Right flanking sequence: AGGAATTGTGattttatttaaattttgttt. D2045.9 crRNA A: ATTTCCCGGTCAACGCAACG; D2045.9 crRNA B: GACACCGAAACCTAAAAGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|