| NJ51 |
C. elegans |
exc-1(rh26) X. Show Description
Excretory canal defect. Large fluid-filled cysts appear randomly along the excretory canal, especially at the tips: 100% penetrant. Cysts often visible as clear spots by low-power microscopy. Shortened canals. Smaller cysts in amphid sheath. Stop mutation in 2nd Ras-like IRGP domain. Encodes homologue of human IRGC. [NOTE (08/2025): The correct genotype of this strain is exc-1(rh26), not exc-3(rh26) as previously described.]
|
|
| NJ545 |
C. elegans |
mua-4(rh177) dpy-17(e164) III. Show Description
Mua, not viable. Cytokinesis is defective in both hypodermis and germline resulting in mutinucleate cells.
|
|
| NJ683 |
C. elegans |
exc-7(rh252) II. Show Description
Excretory canal defect. Canal is invariably short with multiple cysts of varying size clustered along length, especially at the tips. Visible only by Nomarski microscopy. Tail spike is often slightly malformed. Animal is somewhat pale.
|
|
| NJ824 |
C. elegans |
rhIs15. Show Description
rhIs15 [mig-15::GFP]. Superficially. GFP is brighter at 25C.
|
|
| NJ831 |
C. elegans |
exc-3(rh186) X. Show Description
Excretory canal defect. Hypomorphic allele. Canals are slightly shortened. Defect visible only by Nomarski microscopy.
|
|
| NJL4385 |
C. elegans |
nicIs146 II; unc-119(ed3) III. Show Description
nicIs146 [skn-1Ap::mCherry::H2B] II. Fluorescent reporter for transcription of skn-1A. Nuclear-localized mCherry expression in most cells. Reference: Jochim B, et al. PLoS Genet. 2025 Jul 7;21(7):e1011780. doi: 10.1371/journal.pgen.1011780. PMID: 40623109.
|
|
| NJL4435 |
C. elegans |
nicIs148 II; unc-119(ed3) III. Show Description
nicIs148 [skn-1Cp::mCherry::H2B] II. Fluorescent reporter for transcription of skn-1C. Nuclear-localized mCherry expression in most cells. Reference: Jochim B, et al. PLoS Genet. 2025 Jul 7;21(7):e1011780. doi: 10.1371/journal.pgen.1011780. PMID: 40623109.
|
|
| NK1531 |
C. elegans |
unc-119(ed4) III; qyIs366 V. Show Description
qyIs366 [ser-2(prom3)::hpo-30::GFP + unc-119(+)] V. Reporter allows visualization of HPO-30 trans-membrane protein in PVD dendrites. Reference: Zou W, et al. PLoS Genet. 2015 Sep 22;11(9):e1005484. PMID: 26394140.
|
|
| NK1532 |
C. elegans |
qyIs368 I; unc-119(ed4) III. Show Description
qyIs368 [ser-2(prom3)::dma-1::GFP + unc-119(+)] I. Reporter allows visualization of DMA-1 trans-membrane protein in PVD dendrites. Reference: Zou W, et al. PLoS Genet. 2015 Sep 22;11(9):e1005484. PMID: 26394140.
|
|
| NK2322 |
C. elegans |
cle-1(qy22[cle-1::mNG+loxP]) I. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2326 |
C. elegans |
emb-9(qy24[emb-9::mNG+loxP]) III. Show Description
Superficially wild-type. Slow growth. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2353 |
C. elegans |
agr-1 (qy27[agr-1::mNG+loxP]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2404 |
C. elegans |
epi-1(qy31[epi-1::mNG+loxP]) IV. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2413 |
C. elegans |
sdn-1(qy29[sdn-1::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2422 |
C. elegans |
him-4(qy33[him-4::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2425 |
C. elegans |
lam-3(qy28[lam-3::mNG+loxP]) I. Show Description
Superficially wild-type. Slow growth. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2443 |
C. elegans |
nid-1(qy38[nid-1::mNG+loxP]) V. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2444 |
C. elegans |
pxn-2(qy39[pxn-2::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2445 |
C. elegans |
pxn-1(qy40[pxn-1::mNG+loxP]) V. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2456 |
C. elegans |
ddr-1(qy43[ddr-1::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2457 |
C. elegans |
ddr-2(qy44[ddr-2::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2476 |
C. elegans |
ina-1(qy46[ina-1::mKate+loxP]) III. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mKate. Insertion site verified by PCR and sequencing.
|
|
| NK2477 |
C. elegans |
ptp-3(qy47[ptp-3::mNG+loxP]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2500 |
C. elegans |
unc-52(qy53[unc-52::mNG+loxP]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2502 |
C. elegans |
ten-1(qy56[ten-1::mNG+loxP]) III. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2555 |
C. elegans |
unc-52(qy75[mNG+loxP::unc-52]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2557 |
C. elegans |
mig-6(qy73[mig-6::mNG+loxP]) V. Show Description
Superficially wild-type. Specifically tags the long isoform of mig-6. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2565 |
C. elegans |
pxn-2(qy76[mNG+loxP::pxn-2]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2579 |
C. elegans |
fbl-1(qy62[mNG+loxP::fbl-1]) IV. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2580 |
C. elegans |
spon-1(qy30[spon-1::mNG+loxP]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2581 |
C. elegans |
gpn-1(qy35[gpn-1::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2582 |
C. elegans |
lon-2(qy55[lon-2::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2583 |
C. elegans |
unc-52(qy80[mNG+loxP (synthetic exon)::unc-52]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2590 |
C. elegans |
gon-1(qy45[gon-1::mNG+loxP]) IV. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2604 |
C. elegans |
emb-9 (qy89[emb-9::mEos2+loxP]) III. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2623 |
C. elegans |
ucr-2.1(qy92[ucr-2.1::mNG]) X. Show Description
mNeonGreen tag inserted into the endogenous ucr-2.1 locus (C-terminus tag). Insertion verified by PCR. Left flanking sequence: 5' TCAGAAGGAACGACTCGTTG 3' ; Right flanking sequence: 5' CGAAAGTAGAATGCTAGTCAAG 3'. sgRNA: 5' TTTATAGCTCGTCGAGATAT 3'. Superficially wild-type.
|
|
| NK2739 |
C. elegans |
cox-5B(qy137[cox-5B::mNG]) I. Show Description
mNeonGreen tag inserted into C-terminus of endogenous cox-5B locus. Insertion verified by PCR. Left flanking sequence: 5' TACAGCATGTGTAGACAACGAG 3' ; Right flanking sequence: 5' AAAGATGCGCACACAGACACA 3'. sgRNA: 5' TGTTTAGATGGATTCTGGGT 3'. Superficially wild-type.
|
|
| NK2743 |
C. elegans |
cox-10(qy141[cox-10::mNG]) II. Show Description
mNeonGreen tag inserted into C-terminus of endogenous mNeonGreen tag inserted into C-terminus of endogenous cox-10 locus. Insertion verified by PCR. Left flanking sequence: 5' GGCACTCACATTTTCGCGTTA 3' ; Right flanking sequence: 5' TGAAGCGCGTCTAACACGTT 3'. sgRNA: 5' GAACGGCTACAACAAAATGG 3'. Superficially wild-type.
|
|
| NK2765 |
C. elegans |
qySi120[eef-1A.1p::iATpSnFR1.0::unc-54 3'UTR] I. Show Description
Superfically wild-type strain with ubiquitous somatic expression of ATP biosensor iATPSnFR1.0 inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination. Internal iATPSnFR1.0 reverse primer: 5' CTTCATCTCGGCGACGGAGAGACGGTT 3'
|
|
| NK3019 |
C. elegans |
qySi218[rpl-28p::tomm-20::mKate2::3xHA::unc-54 3'UTR] I. Show Description
Superfically wild-type strain with ubiquitous expression of red mitochondria outermembrane marker inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination.
|
|
| NK3027 |
C. elegans |
qySi148 I; lam-2(qy20[lam-2::mNG]) IV. Show Description
qySi148 [lin-29p::2xmKate2::PLCdeltaPH] I. mNeonGreen tag inserted into C-terminus of endogenous lam-2 locus. Superfically wild-type strain with AC-specific plasma membrane marker and BM marker. BM visualized with endogenously tagged laminin. Plasma membrane marker inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination.
|
|
| NK3189 |
C. elegans |
qySi275 I. Show Description
qySi275 [nduv-2p::mNG::P2A::mKate2::unc-54 3'UTR] I. nduv-2 transcriptional reporter fused to mNeonGreen and mKate2. Inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination. Internal mKate2 reverse primer: 5' CCTTGATTCTCATGGTCTGAG 3'. Superfically wild-type.
|
|
| NK3212 |
C. elegans |
cox-4(qy134[cox-4::mNG]) I. Show Description
mNeonGreen tag inserted into C-terminus of endogenous cox-4 locus. Insertion verified by PCR. Left flanking sequence: 5' CACGAAGAGAGAACGGTTTTTGA 3' ; Right flanking sequence: 5' TCGACTGGAAACTCTCGAAGGT 3'. sgRNA: 5' TTCTCGTAATCGTAGTGTGT 3'. Superficially wild-type.
|
|
| NK3325 |
C. elegans |
qySi316 I. Show Description
qySi316 [nuo-1p::mNG::P2A::mKate2::unc-54 3'UTR] I. Transcriptional nuo-1 reporter fused to mNeonGreen and mKate2 inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination. Internal mKate2 reverse primer: 5' CCTTGATTCTCATGGTCTGAG 3'. Superfically wild-type.
|
|
| NKZ352 |
C. auriculariae |
Caenorhabditis auriculariae wild isolate. Show Description
Caenorhabditis auriculariae wild isolate. Male-female strain. Maintain by mating at 25C. Can be maintained on NGM with E. coli. C. auriculariae was initially described as an associate of the fruiting bodies of the basidiomycota fungus Auricularia polytricha and recently reisolated from a Platydema mushroom-associated beetle. References: Dayi M, et al. Additional description and genome analyses of Caenorhabditis auriculariae representing the basal lineage of genus Caenorhabditis. Scientific Reports (in press). Tsuda K & Futai K. Nematological Research (Japanese Journal of Nematology) 1999. 29, 18-23
|
|
| NKZ392 |
C. sp 36 |
Caenorhabditis sp 36 wild isolate. Show Description
Caenorhabditis sp 36 wild isolate. Male-female strain. Maintain by mating. Maintain at 25C. A gonochoristic species isolated from adult weevils (Niphades variegatus), with whom they appear to be tightly associated during its life cycle. A genome comparison highlighted that C. sp. 36 has the smallest genome so far sequenced in the elegans supergroup, despite of being closely related to the largest genome species, C. japonica.
|
|
| NL130 |
C. elegans |
pgp-1(pk17) IV; pgp-3(pk18) X. Show Description
Drug sensitive. No visible phenotype. pgp-1 and pgp-3 deletion alleles.
|
|
| NL131 |
C. elegans |
pgp-3(pk18) X. Show Description
pgp-3 deletion allele. No visible phenotype. Drug sensitive (colchicine, chloroquine). Throws males: outcrossed with him-8(e1489) so probably contains this mutation.
|
|
| NL132 |
C. elegans |
pgp-1(pk17) IV. Show Description
pgp-1 deletion allele. No visible phenotype. Might be sensitive to drugs.
|
|
| NL1604 |
C. elegans |
dpy-20(e1282) IV; pkIs584. Show Description
pkIs584 [gpa-7::GFP + dpy-20(+)]. GFP expression in many neurons, muscle cells, and many neurons in the male tail.
|
|