Search Strains

syIs197 [hs::LIN-3c(cDNA) + myo-2p::DsRed + pha-1(+)]. Him. Maintain at 15C. To induce LIN-3/EGF expression, heat shock at 33C for 30min (water bath) and let animals recover at least 1hr from the behavioral effects of the heat shock. Heat shock-induced LIN-3 should inhibit feeding, locomotion and sensory responses for several hours. For details on EGF-induced quiescence, see Nature Neuroscience 10, 1300 - 1307 (2007). PS5970 is identical to PS5628 as described in Development 137, 2065-2074 (2010) except that it has been outcrossed to remove accumulating suppressors.

syEx1136 [myo-2p::GFP + unc-119(+)]. unc-119 animal rescued with array that expresses GFP in the pharyngeal muscles. Pick non-Unc animals to maintain the array. Highly outcrossed version of unc-119(ed3) generated by the Sternberg lab. Pick Unc animals for heavily outcrossed unc-119(ed3) to use for out-crossing biolistic insertions, mosSCI insertions or miniMos insertions based on unc-119 selection. Reference: Frokjær-Jensen C, et al. Nat Methods. 2012 Jan 30;9(2):117-8.

syEx1147 [des-2::DES-2::GFP + pha-1(+) + pBluescript KS(+)]. Maintain at 25C to select for presence of transgene. GFP reporter is driven by the promoter of the des-2/des-3 operon and is expressed in ALA, RID, PVD, FLP, IL2, PLM, PVC, and M1 muscles of the pharynx. This construct contains 3.4 kb of sequence upstream of the des-2 start ATG (Treinin et al., 1998) (Van Buskirk and Sternberg, 2010).

Transformation of ray 6 to a thin ray which is anteriorly displaced and fuses with ray 4 (95%). A 10th ray is found in about 50% of the sides scored. Body is slightly shorter. Do not distribute this strain; other labs should request it from the CGC.

syIs243 [myo-3p::TOM20::mRFP + unc-119(+) + pBS Sk+]. Integrated from PS6053. Strain has been outcrossed, but not known if unc-119 mutation is still present in the background.

syEx1341 [ges-1p::fars-1(T412G)::fib-1::rps-16::GFP(S65C, SynIVS)::unc-54 3' UTR + myo-2p::DsRed::unc-54 3' UTR + pha-1(+) + pBluescript]. GFP expression in the intestine. Maintain at 25C and pick animals with red fluorescence in pharynx. Expresses a phenylalanyl-tRNA capable of tagging proteins with the non-canonical amino acid p-azido-L-phenylalanine in the intestine. Reference: Yuet KP, et al. Proc Natl Acad Sci U S A. 2015 Mar 3;112(9):2705-10.

syEx1342 [myo-2p::fars-1(T412G)::fib-1::rps-16::GFP(S65C, SynIVS)::unc-54 3' UTR + unc-122p::mCherry::unc-54 3' UTR + pha-1(+) + pBluescript]. GFP expression in the pharynx. Maintain at 25C and pick animals with red fluorescence in coelomocytes. Expresses a phenylalanyl-tRNA capable of tagging proteins with the non-canonical amino acid p-azido-L-phenylalanine in pharyngeal muscle. Reference: Yuet KP, et al. Proc Natl Acad Sci U S A. 2015 Mar 3;112(9):2705-10.

syEx1343 [myo-3p::fars-1(T412G)::fib-1::rps-16::GFP(S65C, SynIVS)::unc-54 3' UTR + myo-2p::DsRed::unc-54 3' UTR + pha-1(+) + pBluescript]. GFP expression in body wall muscle. Maintain at 25C and pick animals with red fluorescence in pharynx. Expresses a phenylalanyl-tRNA capable of tagging proteins with the non-canonical amino acid p-azido-L-phenylalanine in body wall muscle. Reference: Yuet KP, et al. Proc Natl Acad Sci U S A. 2015 Mar 3;112(9):2705-10.

syEx1344 [rab-3p::fars-1(T412G)::fib-1::rps-16::GFP(S65C, SynIVS)::unc-54 3' UTR + myo-2p::DsRed + pha-1(+) + pBluescript]. GFP expression in neurons. Maintain at 25C and pick animals with red fluorescence in pharynx. Expresses a phenylalanyl-tRNA capable of tagging proteins with the non-canonical amino acid p-azido-L-phenylalanine in neurons. Reference: Yuet KP, et al. Proc Natl Acad Sci U S A. 2015 Mar 3;112(9):2705-10.

syIs337 [15xUAS::?pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] III. syIs401 [hsp16.41p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)].  syIs337 is a GFP cGAL effector. syIs401 is hsp-16.41 cGAL driver for heat shock promoter. Low levels of GFP fluorescence in a few head neurons without heat shock. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

syIs406 [15xUAS::?pes-10::GFP::H2B::let-858 3'UTR + ttx-3p::RFP + pBlueScript].  GFP::H2B effector.  Very weak background fluorescence in first ring of intestinal cells and posterior intestinal cells.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

syIs407 [15xUAS::?pes-10::GFP::H2B::let-858 3'UTR + ttx-3p::RFP + pBlueScript].  GFP::H2B cGAL effector.  Very weak background fluorescence in first ring of intestinal cells and posterior intestinal cells.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

syIs409 [15xUAS::?pes-10::mCherry::H2B::let-858 3'UTR + unc-122p::GFP + pBlueScript].  mCherry::H2B cGAL effector.  Very weak background fluorescence in first ring of intestinal cells and posterior intestinal cells.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of K03E5.2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: tatattttttgaaattttccagggaATGACCGGTT; right flanking sequence: GTCAAGGGAAAGCATTTGAAGAGAATTTGGGAGCT; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc sgRNA: ATTGCTTGGCACCTCGACGG Reference: Wang H, et al. G3 (Bethesda).

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of T05C3.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTCACCGATACAACTGTAGAACGAAACGCGCTAA Right flanking sequence: TGGAGGAGATTTATCCAAAGCTTAAGGAATACTGC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGAACGAAACGCGCTAATGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clik-1(T25F10.6) Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGAGGAGATCGAGGAGGACGAGCCAGTCGCCGACG; right flanking sequence: AGAACCAAGAGCCAGAGgtaatcgttttttgccat; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda).

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of K03E5.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: aaaattttcagAAGCTGGCCTCAAAATTGCCGCCG Right flanking sequence: TCTCGAGGTGCCAAGCAATGAACAATTGGAGAGGAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATTGCTTGGCACCTCGACGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of Y106G6H.8 Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTAATCTCCCCACCAAGTGTCGATATGTCTCCAATT; right flanking sequence: ATTCGTCTGGCTGGCCTCTCGGGAGCTGTTGCCATTTC; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda).

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of aex-2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGGAAACGGCTTTTATGGATTACTGCAGCGACATG Right flanking sequence: GGGAGGACTTTATGCAATGAACATCGCACTTGTCA inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATTACTGCAGCGACATGGGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C01B10.10; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: catcatcagAATATGGACCCGCGTGTATGTCCAATT Right flanking sequence: CAACATGGACCCAGAGCCCTCAAAAATGGGTCGATG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GCTCTGGGTCCATGTTGAAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. a weak allele for C53C9.2 ; 58 bp insertion from downstream sequence of its own and 1 bp deletion (leading to change of an animo acid and insertion of 19 amino acids in frame); balanced with FX30326, further confimed by genotyping for homozygotes of C53C9.2 Left flanking sequence ACCGCTGTCGGTATGCCACGTTGGAATATCACCAAG; Right flanking sequence: ACAAGAAGCAAGGATACATCGCTCCAGATCAGAGATCTG; inserted sequence between the two flanking sequence: CTCGGAGAAGACATTCTCCGACGAGGAACCGAATTCACACCATGGTACTCTGGACAAA. sgRNA : GTATCCTTGCTTCTTGTCCT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Dumpy. Viable allele of let-23. Vul. Do not distribute this strain; other labs should request it from the CGC.

Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of C56G2.15. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTCGTGAGCATTCACAGAAAAAATCATGCCGTCA; right flanking sequence: GTCCCCTCCAATGTCGTTTTTGTTGCTCAATAAGG; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda).

Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of C53C9.2. lethal strain balanced with tmC30[ubc-17(tmIs1243)] X (from parental strain FX30236; dominant red pharynx and recessive Lon Mec); this strain segregates wild type, long animals, and L1 arrested homozygotes. Pick wild-type animals to maintain the heterozygotes. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGCTGTCGGTATGCCACGTTGGAATATCACCAAGG; right flanking sequence: ACAAGAAGCAAGGATACATCGCTCCAGATCAGAGATC; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda).

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C01B10.4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ATACACACTTCATTTGGTCATTTGGAAGGTGCAGA Right flanking sequence: GATAGGAGATTATCATTTGTTCAAAAAAATTCCATTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CATTTGGAAGGTGCAGAGAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of adm-4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTTTGTTGATGACACGTTACATCTAGAGCCATCT Right flanking sequence: TACCCGCATCAACTTTCTGATGATCTTGGGCCTGTTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GAAAGTTGATGCGGGTAAGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C23H4.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gtaattgaaacgaagaccatgccatgcagttccagAG Right flanking sequence: TGTTCCGTTTGCAAAGCCACCAATTGGAAATTTGC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GCTTTGCAAACGGAACACTC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C04G6.4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGAAGCCACTTTCTTTCGAAATGCCAAAACCGCCA Right flanking sequence: GTTCTCCAGCCAAATATTGCCTCACTTCTACAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATATTTGGCTGGAGAACTGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ttc-36; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAGCTCAGTTTGCAGCTCGAGAGAGAAGGTGTCG Right flanking sequence: cCGTTGGCAGAAGGTGTACGGTTGGATGAAGCTATTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CGAGAGAGAAGGTGTCGCGT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Unc. Viable allele of let-23. Vul. Do not distribute this strain; other labs should request it from the CGC.

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ZC376.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCCTGGGACGGAGTTTTGGAGGCGAAGGAGTATA Right flanking sequence: AAGCGGCTTGTATGAGTGATCAGAAgtaagagata inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGAGGCGAAGGAGTATAAAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of cpn-4 (F49D11.8). Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGCAAGCAAGTTCAATGATGTTGAAGCTGGATACT; right flanking sequence: TGTTGGAATGGATTCGGgtaagatttgggtagatt; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda).

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of Y55F3BL.4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAAGACGACGGATTCACCCTGGTCACTGGTAGAAA Right flanking sequence: AGCCGGAAAACAGTCGGCGAAATTTgtcagttttc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTGGTCACTGGTAGAAAAGC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

syIs503 [15xUAS::Chrimson::GFP::let-858 3'UTR + unc-122p::GFP + 1kb DNA ladder (NEB)]. Red light-activated channelrhodopsin cGAL effector. Reference: Cao M, et al. Application of the red-shifted channel rhodopsin Chrimson for the Caenorhabditis elegans cGAL bipartite system. MicroPubl Biol. 2018 Aug 22;2018:10.17912/2JGW-FJ52. doi: 10.17912/2JGW-FJ52. PMID: 32550400.

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-67; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTCACTTTCTTGCTCGTCACTCTTTTTGCCCTCGC Right flanking sequence: CAATGTCATGCAAGCACAGCGTTACGATCGAGCC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GTGCTTGCATGACATTGGCG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of R173.3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTCGAATTGAGGGTCAACTCTGGAGCAATCCG Right flanking sequence: taagtacatgattttttattc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TTCTTACCAGTCGCTCTCCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of cest-1; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATTGGAGACCTTCGATATCGAAAACCCCGTCCACCG Right flanking sequence: AAATCATGGGAAGGAGTTTTGGTAACAAATGAATA inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ACTCCTTCCCATGATTTCGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of F13H6.3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATGGGTACCTCGGGATCCCGTATGCGAAACCACCA Right flanking sequence: GTCGGCGAACTTCGATTTAAGAAGCCAGTAACCGTTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AATCGAAGTTCGCCGACTGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dod-18; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCATTGAAACAGCTAAAGGAAAATTGACGACTA Right flanking sequence: TTGTGGAAGAAATGAAAAGAAAAGAGgtatagtta inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGGAAAATTGACGACTATTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C17H12.4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATTGGAAAATTAAGATTTCAAAAACCAGAACCGCCT Right flanking sequence: GAGAAATGGACCGGAGTGAGAAATGCAAAAGgtatg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ACTCCGGTCCATTTCTCAGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srx-51; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAACTCATTTGGAATGCTGACTACATCACAGTCTA Right flanking sequence: TTGGGGATGCAGTTATTTCAACAATTTTTGCATTT inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GACTACATCACAGTCTATTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of gnrr-4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGGACTGCATCGTTCTCTTTATCTACGCTCCAACT Right flanking sequence: CAGTTTGCATGGATTCACTCATACTGGgtaagtctg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGAATCCATGCAAACTGAGT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of Y55B1BR.1; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCGTACCCGTAGAATGCTTGAAGAAATGGCCGGCC Right flanking sequence: TCGTGGGAACTAAACCATTGAGCCAGCTTCCTCGAAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGAAGAAATGGCCGGCCTCG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-23. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTGCTTCACCAACTTGATCGCGTTGCTCGTATTGG; right flanking sequence: TGCCGGTGATCATTCATAACGTGTTCACCGGTGTC. Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CGCGTTGCTCGTATTGGTGC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of pals-14; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: TTAAATCCAGTTTAGCAGAGAGAAAAGCGGCAGAG Right flanking sequence: GAGAGGCACAACAAAGCGgtatgatcatgcttacc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGAGAAAAGCGGCAGAGGAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of pals-16; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGAATCATTGACAAATTGCAGAACATCAACACCTT Right flanking sequence: Ggtaggttgaagaagttattattggaatttgaaat inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CAGAACATCAACACCTTGGT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of H39E23.3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCGGTCACTGTTCAAGGATTCCCTACAAAAGATC Right flanking sequence: GTGAGGCCAGAGAGACTGAACCAGTGAAACTGCCAAC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATTCCCTACAAAAGATCGTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-76; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: cagTGTTCATCGCAATCTGCGTGCTCTCCCAAAA Right flanking sequence: CGCTATGGCCCTCCGTGGTGCACTATTCCGTTCTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CACGGAGGGCCATAGCGTTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-77; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GACAACCAGCCGGAGGTCAAGATGTTCCACCATTC Right flanking sequence: CTTCGTAATGCCACTCCAGCTCAACTTCAGAGCTTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGAGTGGCATTACGAAGGAA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616