More Fields
Strain Species Genotype
PS8191 C. elegans nlp-77(sy1216) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-77; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GACAACCAGCCGGAGGTCAAGATGTTCCACCATTC Right flanking sequence: CTTCGTAATGCCACTCCAGCTCAACTTCAGAGCTTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGAGTGGCATTACGAAGGAA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
RB1358 C. elegans C06A8.3(ok1525) II. Show Description
C06A8.3 Homozygous. Outer Left Sequence: ctggtcaacttcagcgaaca. Outer Right Sequence: ttggcactcacatcagaagc. Inner Left Sequence: ggacatccctcatcagtcgt. Inner Right Sequence: gtcctttttcaaatccgcaa. Inner Primer PCR Length: 2211. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807