Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
PS7778 C. elegans clik-1(sy1084) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clik-1(T25F10.6) Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGAGGAGATCGAGGAGGACGAGCCAGTCGCCGACG; right flanking sequence: AGAACCAAGAGCCAGAGgtaatcgttttttgccat; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda).
RB1820 C. elegans T25F10.6(ok2355) V. Show Description
T25F10.6. Homozygous. Outer Left Sequence: TGAATAGACGTGTCGTTGCC. Outer Right Sequence: CCTCATTCTGGGACGTGTTT. Inner Left Sequence: ATGTGGGTGGAGATGATGGT. Inner Right Sequence: TGACGTCGAAGACGAGTACG. Inner Primer PCR Length: 2512 bp. Deletion Size: 1021 bp. Deletion left flank: GACTCCCATCTGGTATGGAATCATTCCCTG. Deletion right flank: CTTGAATTGGGATAATTCCCTCGGATCTCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
MQ1395 C. elegans clk-1(e2519) III; rte-1(qm199) X. Show Description
qm199 suppresses the growth arrest and sterility of clik-1(e2519) on ubi- bacteria.
MQ1403 C. elegans rte-2(qm210) I; clk-1(e2519) III. Show Description
qm210 suppresses the growth arrest and sterility of clik-1(e2519) on UQ- bacteria.
MQ1407 C. elegans clk-1(e2519) III; rte-4(qm213) X. Show Description
qm213 suppresses the growth arrest and sterility of clik-1(e2519) on ubi- bacteria.
MQ1408 C. elegans clk-1(e2519) III; rte-3(qm211) X. Show Description
qm211 suppresses the growth arrest and sterility of clik-1(e2519) on ubi- bacteria.
ON352 C. elegans clik-1(kt1[clik-1::gfp]) V. Show Description
GFP tag inserted into endogenous clik-1 locus. CLIK-1::GFP is expressed in body wall muscle, vulval muscle, and myoepithelial sheath of the somatic gonad and co-localized with actin filaments. Reference: Ono S & Ono K. J Biol Chem. (2020) 295(34):12014-12027. PMID: 32554465