More Fields
Strain Species Genotype
PS8189 C. elegans nlp-76(sy1214) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-76; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: cagTGTTCATCGCAATCTGCGTGCTCTCCCAAAA Right flanking sequence: CGCTATGGCCCTCCGTGGTGCACTATTCCGTTCTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CACGGAGGGCCATAGCGTTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9550 C. elegans syIs815; syIs337. Show Description
syIs815 [nlp-76p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASH neurons. syIs337 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector.