Search Strains

umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick wild-type GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal deletion balanced over mIn1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, arrested GFP+ non-mKate2 (hd7010 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Derived from parental strains VH7029 and CGC53. hd7010 is a 180 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking sequence: ATGGATCCATGTTTCATAAAGGATGTTTTA; Right flanking sequence: ATCAAATCTTCTTTTCTCGCCAAAAACGAA. sgRNA #1: AATGTTGGATTTGCGGAACC; sgRNA #2: CGATGTGGAATTGGATCATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5656 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4586 and CGC63. gk5656 is a 2105 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATCAGCAGCTAATTTTCCATTTTTCCACTC. Right flanking sequence: TCAGCGACTCCAACGTTGATTGAGCAGTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 (gk5869 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4801 and CGC63. gk5869 is a 3129 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CTCTCAATTTTCAGATGCTTCGTTCCTCAA. Right flanking sequence: CGTGGTCACCTTCTCGATCCGAAATAATTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (L1-L2 stage lethal), and non-GFP mKate2+ mIn1 homozygotes. Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. Derived from parental strains VC4065 and CGC53. gk5139 is a 5156 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAAAAGTCTGATGAAGATTCTGAGCCACCA. Right flanking sequence: TACCAATGTTCCAGATATTCGTGTCAGCTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Apparent homozygous lethal or sterile deletion balanced over labeled mT1. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+, GFP+ non-mKate2 gk5627 homozygotes, sterile Dpy mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ & mKate2+ and check for correct segregation of progeny to maintain. Derived from parental strains VC4556 and CGC66. gk5627 is a deletion of 2142 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GATGGGAGGACAAAGAGCAAAGCGGAGATG. Right flanking sequence: ATATTTCCGGTGCTCCAATTCTGTGTCCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Apparent homozygous lethal or sterile deletion balanced over labeled mT1. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+ heterozygotes, GFP+ non-mKate2 gk5753 homozygotes, sterile Dpy mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. [NOTE: there is also red fluorescence apparent in the hypodermis or body wall.] Maintain by picking wild-type GFP+ & mKate2+ and check for correct segregation of progeny to maintain. Derived from parental strains VC4684 and CGC66. gk5753 is a deletion of 2118 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCGAATACAAGAAATTGTCAGAAACCGGGG. Right flanking sequence: GACGCCACCTCAATTTTTGGTTTTTATTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Apparent homozygous lethal or sterile deletion balanced over labeled sC1. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+ heterozygotes, GFP+ non-mKate2 gk5290 homozygotes (Let), and Dpy mKate2+ sC1 homozygotes. Maintain by picking wild-type GFP+ & mKate2+ and check for correct segregation of progeny to maintain. Derived from parental strains VC4205 and CGC51. gk5290 is a deletion of 2953 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CAGATTCGACGACAGATGACGAATGGACGG. Right flanking sequence: CACGGATTCAGGTCGAACACATTTTTAATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Apparent homozygous lethal or sterile deletion balanced over labeled sC1. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+ heterozygotes, GFP+ non-mKate2 gk5584 homozygotes (Let), and Dpy mKate2+ sC1 homozygotes. Maintain by picking wild-type GFP+ & mKate2+ and check for correct segregation of progeny to maintain. Derived from parental strains VC4513 and CGC51. gk5584 is a deletion of 1745 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTGAGATCCAAAAAGAATTCTCGGGTGTGT. Right flanking sequence: ATTGGTCAGAACTTTCTGATTTGTCGGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Apparent homozygous lethal or sterile deletion balanced over labeled mT1. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+, GFP+ non-mKate2 gk5627 homozygotes, sterile Dpy mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ & mKate2+ and check for correct segregation of progeny to maintain. Derived from parental strains VC4716 and CGC66. gk5785 is a deletion of 1919 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CGGGAAATCTGTTTTAAAAATGTTTGCCCG. Right flanking sequence: TTTTCCAATAATCCAATACCCATTTAATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Apparent homozygous lethal or sterile deletion balanced over labeled mT1. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+, GFP+ non-mKate2 gk5392 homozygotes, sterile Dpy mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ & mKate2+ and check for correct segregation of progeny to maintain. Derived from parental strains VC4309 and CGC66. gk5392 is a deletion of 9220 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TGTTTACACGCCCACCAATCTTCCCCGCCC. Right flanking sequence: TTCGGACCTTCACTGGATGTAGCTCGGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

stIs11966 [F44E2.7b.1::H1-wCherry + unc-119(+)].

foxSi27 [pie-1p::tomm-20(gDNA)::mKate2::HA::tbb-2 3'UTR ] I. Single-copy MosSCI insertion into oxti185. Germline-specific expression of TOMM-20::mKate2::HA can be used for fluorescent identification of germline mitochondrial morphology and tissue-specific isolation of mitochondria. Reference: Ahier A, et al. Nature Cell Biol. 2018 Mar;20(3):352-360. doi: 10.1038/s41556-017-0023-x. PMID: 29358705.

foxSi37 [ges-1p::tomm-20::mKate2::HA::tbb-2 3' UTR] I. Transgene inserted into oxTi185. Superficially wild-type. Gut-specific expression of reporter construct. This strain is part of toolkit to affinity purify mitochondria from specific tissues. Reference: Ahier A, et al. Nat Cell Biol. 2018 Mar;20(3):352-360.

foxSi39 [gcy-6p::tomm-20::mKate2::HA::tbb-2 3' UTR] I. Transgene inserted into oxTi185. Superficially wild-type. ASE-specific expression of reporter construct. This strain is part of toolkit to affinity purify mitochondria from specific tissues. Reference: Ahier A, et al. Nat Cell Biol. 2018 Mar;20(3):352-360.

foxSi41 [dpy-7p::tomm-20::mKate2::HA::tbb-2 3' UTR] I. Transgene inserted into oxTi185. Superficially wild-type. Hypodermal expression of reporter construct. This strain is part of toolkit to affinity purify mitochondria from specific tissues. Reference: Ahier A, et al. Nat Cell Biol. 2018 Mar;20(3):352-360.

foxSi44 [rgef-1p::tomm-20::mKate2::HA::tbb-2 3' UTR] I. Transgene inserted into oxTi185. Superficially wild-type. Neuronal expression of reporter construct. This strain is part of toolkit to affinity purify mitochondria from specific tissues. Reference: Ahier A, et al. Nat Cell Biol. 2018 Mar;20(3):352-360.

foxSi75 [eft-3p::tomm-20::mKate2::HA::tbb-2 3' UTR] I. Transgene inserted into oxTi185. Superficially wild-type. Ubiquitous expression of reporter construct. This strain is part of toolkit to affinity purify mitochondria from specific tissues. Reference: Ahier A, et al. Nat Cell Biol. 2018 Mar;20(3):352-360.

foxSi16 [myo-3p::tomm-20::mKate2::HA::tbb-2 3' UTR] I. Transgene inserted into oxTi185. Superficially wild-type. Muscular expression of reporter construct. This strain is part of toolkit to affinity purify mitochondria from specific tissues. Reference: Ahier A, et al. Nat Cell Biol. 2018 Mar;20(3):352-360.

hrtSi28 [des-2p::mKate2::maph-1.1 + unc-119(+)] IV. hrtSi28 inserted into cxTi10882. Expression of mKate2::MAPH-1.1 microtubule marker in PVD and FLP. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111.

hrtSi57 [gcy-36p::gcy-35::mKate2 + unc-119(+)] II. hrtSi57 inserted into ttTi5605. mKate2 inserted into gcy-35 after S671 to generate a functional expression construct (Gross et al., 2014). Reference: Harterink M, et al. J Cell Sci. 2018 Oct 22;131(20):jcs223107. PMID: 30254025.

hrtEx161 [des-2p::PA-GFP::tba-1 + des-2p::mKate2 + unc-119(+) + myo-2p::mCherry]. Pick mCherry+ animals to maintain array. PA-GFP::TBA-1 expression in PVD and FLP; fluorescence can be induced illumination by blue light. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111.

flvIs17 [tag-168::NLS::GCaMP7F + gcy-28.d::NLS::tagRFPt + ceh-36::NLS::tagRFPt + inx-1::tagRFPt + mod-1::tagRFPt + tph-1(short)::NLS::tagRFPt + gcy-5::NLS-;:tagRFPt + gcy-7::NLS::tagRFPt]. flvIs18 [tag-168::NLS::mNeptune2.5]. This strain can be used for calcium imaging at whole-brain level. Back-crossed 5x to MT21793 after transgene integration. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

bmdSi339 [loxN::lin-29p::FLP::p2A::H2B::2xmTurq2] I. bmdSi297 [loxN::rpl-28p::FRT3::STOP::FRT3::TIR1(F79G)::T2A::DHB::2xmKate2] II. qyIs225 [cdh-3p::mCherry::moeABD] V. mNG tags inserted into endogenous arx-2 and lam-2 loci. Wild-type growth and movement. Reference: Xiao Y, et al. Genetics. 2023 PMID: 36722258.

bmdSi339 [loxN::lin-29p::FLP::p2A::H2B::2xmTurq2] I. bmdSi297 [loxN::rpl-28p::FRT3::STOP::FRT3::TIR1(F79G)::T2A::DHB::2xmKate2] II. qyIs225 [cdh-3p::mCherry::moeABD] V. AID* and mNG tags inserted into endogenous arx-2 locus. mNG tag inserted into endogenous lam-2 locus. Wild-type growth and movement. Reference: Xiao Y, et al. Genetics. 2023 PMID: 36722258.

F53E2.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807. gid-8 formerly known as tag-304.

F43E2.8. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R12E2.10. Superficially wild type. External left primer: TGGACAGCTCGTTGTACTGG. External right primer: GAAAGGTCAGAACTCCAGCG. Internal left primer: AAGCCGCTCTAGAAACTCCC. Internal right primer: TTGTCGAGGAGACGGAGACT. Internal WT amplicon: 2457 bp. Deletion size: 1171 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F43E2.7. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1800 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AGCGTATCAAGTCGCTCGTT. External right primer: AAACCTCAGCGGTCAGAAGA. Internal left primer: ATTGGATGGATCATCGGGTA. Internal right primer: GCATCTTCCTCGACTTGTCC. Internal WT amplicon: 2135 bp. Deletion size: 1182 bp. Deletion left flank: CTCGAAAAATACATTATAGCGAAGATTGGA. Deletion right flank: ATTTCTCCTGTAAAACTGAATTTCAAATCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F43E2.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F44E2.8, F44E2.9. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2134 homozygotes (sterile, lays no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAGCTGGTTGGTTTCACCAT. External right primer: ATATGTGGAACTTGCCGGAG. Internal left primer: CATTGGAGAGAGCTTAGGCG. Internal right primer: TCGTTTTTAAATTTCCGCCA. Internal WT amplicon: 2111 bp. Deletion size: 1195 bp. Deletion left flank: TTTTTGTCGAACTTCATTCTTTACTTTACT. Deletion right flank: GGAAATAAAATCGATAAAAACTTTAAAATT. Insertion Sequence: CACGACTTCCTGTTTCTTCAGAAAAACTCTGAATGGCCGTTTCCCATTTTGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C06E2.1. External left primer: ACATTTCCTAGCGCGTCATT. External right primer: GGTCAACTTTTCCGGTGAGA. Internal left primer: TTTAACAGCAGCAGCGGAC. Internal right primer: CTGTGACAAATGCTCACGCT. Internal WT amplicon: 3075 bp. Deletion size: 2173 bp. Deletion left flank: GCCAGTTTTCTTTCAAATGTGTATCTCTTC. Deletion right flank: CAAAAACCCTAAAACTCTAAAACGATTCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R12E2.9. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Deletion chromosome appears to carry a second-site mutation in bli-4. Heterozygotes are Bli with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2377 homozygotes (early larval arrest, Dpy). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick Bli GFP and check for correct segregation of progeny to maintain. External left primer: AACAAGCCACACCGATAAGG. External right primer: GCAGACAAAAGGACCTGCAT. Internal left primer: TCGATGTTCGGAATACGATG. Internal right primer: TTTTAGATTATTTCAAAAGCGCA. Internal WT amplicon: 3163 bp. Deletion size: 1297 bp. Deletion left flank: CGAAGCATGGAAGAAATGTTGGAAAGACGT. Deletion right flank: AAGTCATATATTGTTTGATATCAATTATTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W03D8.6, C11E4.3, F13D12.4, W03D8.5, F48E2.4, F49E2.7, F48E2.9, C11E4.1, C11E4.2, C11E4.17, C11E4.15, C11E4.14, C11E4.10, C11E4.9, C38C5.2. The gk3108 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: CATTTGGCTGGGTCAACTTT. External right primer: TATTGTAAGGATCTGCCCCG. Internal left primer: TTGCACCAAAATGATGGAAA. Internal right primer: CTCAGACAACAAGATCCGCA. Internal WT amplicon: 2496 bp. Deletion size: 1960 bp. Deletion left flank: GTAGGAGTTGTTGCGTGGAAGGTCACACGC. Deletion right flank: AAATTGCGAACACAATTTTGAAATTCAAAA. Other lesions identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Nonsense allele and splicing defect identified by amplicon sequencing.

Homozygous viable. Deletion of 792 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TATTGGAATATTATGAAAATGAGAAAACAA. Right flanking sequence: TGGCGGTAGCGGTGGCGGCGGTCATTCTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1115 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: CATGAATGGGGCGTCCGAATTGTTGTCCCG. Right flanking sequence: TTTAGCTGTTTGGCGGCCAATTGACGCGAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

F18E2.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok830 homozygotes (probable early larval arrest). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C37E2.4. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT and segregate WT, arrested szT1 aneuploids, Lon-2 males, and ok795 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F53E2.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807. gid-8 formerly known as tag-304.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7082 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7082 and CGC66. hd7082 is a 525 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7087 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7087 and CGC66. hd7087 is a 442 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7098 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7098 and CGC66. hd7098 is a 5984 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7099 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VH7099 and CGC92. hd7099 is a 1508 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7083 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7083 and CGC66. hd7083 is a 1871 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7091 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7091 and CGC66. hd7091 is a 5126 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7096 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VH7096 and CGC92. hd7096 is a 667 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7109 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7109 and CGC66. hd7109 is a 472 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7100 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7100 and CGC66. hd7100 is a 572 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7101 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7101 and CGC66. hd7101 is a 1562 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7124 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7124 and CGC66. hd7124 is a 3032 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CTATCAATGCTTTTTTATTGTGTGACAAGA; Right flanking sequence: CGCGAAAAATTCCAGGTTTTTTCCCATTTT. sgRNA #1: TTCGCGTGAGAGTTAGAAGC; sgRNA #2: CTCCATTGACAATCGTCTGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.