Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
RG3543 C. elegans tsct-2(ve1043[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Sterile. Deletion of 9001 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, sterile GFP+ non-mKate2 (ve1043 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GAGAATAAGGAGAAGAAGCAACAAGTACCG; Right flanking sequence: CGGGTAGCTAACTAAAATGTGAAGAGCTAT. Y48C3A.12 sgRNA A: GGTGTATTCATCGGTGTCGG; Y48C3A.12 sgRNA B: TCCCCCGTCCAAACCACGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5002 C. elegans +/mT1 [umnIs52] II; psd-1(gk5580[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5580 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4509 and CGC66. gk5580 is a 6731 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TACAAGCTCGACACTTGCCACGTGGACTAA. Right flanking sequence: TCTGGCGGACCGAAGAACGTTGAAAAGTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5003 C. elegans dxbp-1(gk5666[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5666 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4596 and CGC92. gk5666 is a 2234 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGTGGGCGGCAAAATATTTTTTCCGCCAAACCGGCAAATTGCCGGAATTGAAAATTTCCG. Right flanking sequence: TTCGGAAGTTAAGTGGCATTTGAAGCCGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5004 C. elegans eif-3.G(gk3804[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk3804 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC3837 and CGC48. gk3804 is a 717 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTGTTATCCGATGGCCAAAAAATTCGCCT. Right flanking sequence: AATGATATCCGAATGTACCATATGGTTCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5005 C. elegans F10B5.2(gk5455[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5455 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4374 and CGC48. gk5455 is a 2246 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACTGCGATCTTGCTTCAAGCTATGCGAATG. Right flanking sequence: TCCGAGACTCTGCACACGCCGGTGATGATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5006 C. elegans stip-1(gk5457[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5457 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4376 and CGC48. gk5457 is a 3229 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTGGTGCCATTGGTGGTGGTGGAGCCATTG; Right flanking sequence: TTTGGCTGCATGTTGTTTAGTGGCATGCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5007 C. elegans glb-4(gk5468[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5468 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4390 and CGC48. gk5468 is a 5263 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGGAACATACTTCTTCGTCGATATGGAGTA; Right flanking sequence: ATGTACTACATGTTTTCGATGTGTAGATAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5008 C. elegans tars-1(gk5534[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5534 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4460 and CGC48. gk5534 is a 2908 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AATTCAATGCATTAGAAGACGTGGGCGCGT. Right flanking sequence: TACGGGAGAGGCAGAGTGCACAGAGGAGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5009 C. elegans pdha-1(gk5568[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5568 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4497 and CGC48. gk5568 is a 1334 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TATATTTACTGCTTTCAGTAGCTTGGTACA. Right flanking sequence: ATTGGAAGAGCTTAAACGACACGAATTTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5010 C. elegans sap-49(gk5542[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5542 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4469 and CGC48. gk5542 is a 1365 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGTGACTAATTAGTTTTGGTGTGTCCTCCG. Right flanking sequence: GACGTTCCCGAATCAACATCTCTCATGATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5011 C. elegans mecr-1(gk5557[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5557 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4485 and CGC48. gk5557 is a 1365 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCATGATCAATCTTCACATCACATTAAATT. Right flanking sequence: CGGAATTCGCACAGTTTACACAGATTTTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5012 C. elegans pno-1(gk5573[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5573 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4502 and CGC48. gk5573 is a 3472 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GACTGAATGGGTGAAGGGGCACTATATTGG. Right flanking sequence: TTTGGAGCAGTGTCCAAATTTTGCTCGAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5013 C. elegans eif-2Bepsilon(gk5600[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5600 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4529 and CGC48. gk5600 is a 2890 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAAATTTTGCAGATGCAATGACGCCCTACC. Right flanking sequence: CTTGTTATGACTGAAAGTTTTCAACCACTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5014 C. elegans eif-3.F(gk5606[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5606 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4535 and CGC48. gk5606 is a 1569 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGCTTCGAATTTAACTGTCAATGTCCACCC. Right flanking sequence: CCCTCCCGAATTTGAAATTAGCGTTTCCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5015 C. elegans tpi-1(gk5612[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5612 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4541 and CGC48. gk5612 is a 3448 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CTCCTGGGCTTGTTCTCCAGAAGCAGTCTT. Right flanking sequence: TTTGGCGAAAACTCGATTTTTTACCAAAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5016 C. elegans F59B10.3(gk5677[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5677 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4607 and CGC48. gk5677 is a 2307 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAGAAGAGGCGGAGGATTGCGGCGATATGT. Right flanking sequence: CGATTTTCTGTAAATATTTGCTCAAACCTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5017 C. elegans tnc-2(gk5693[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5693 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4623 and CGC48. gk5693 is a 2787 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAGTTTAGTCGGTTTTTCTGATATCCAGGT. Right flanking sequence: CATTCACTGACTTCCAATAATTCTTTTTGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5018 C. elegans iars-2(gk5471[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])//hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5471 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4393 and CGC92. gk5471 is a 3877 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAAATATTCGAACTTCTCGATGGTCCACCA; Right flanking sequence: ATAGAAAACAGGATTTGATGTTGAAAATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5019 C. elegans F28D9.4(gk5478[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5478 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4400 and CGC92. gk5478 is a 2626 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTTTTACCTATTGCTTTTGCTCTGTAGTA; Right flanking sequence: GACGGTGTTGCTGCTGGGCTGCTGCTCAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5020 C. elegans hrpr-1(gk5481[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5481 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4403 and CGC92. [NOTE: RG5020 and the parental strain VC4403 exhibit weak red fluorescence. The cause of this fluorescence is unknown, but gk5481 is a clean deletion/insertion confirmed by PCR.] gk5481 is a 2871 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGCTTTCAGGCAATCGTCACGCTCGTTGA; Right flanking sequence: GGCGGGAGATCTGCAAAAATCGATAATCTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5021 C. elegans spcs-1(gk5510[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])//hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5510 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4435 and CGC92. gk5510 is a 735 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TAAAACCGCTCCAGCGCGGTACATTTCTGT; Right flanking sequence: GTAAAATAGAGATTTTCCATGGAGCGCACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5022 C. elegans nola-3(gk5610[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5610 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4539 and CGC92. gk5610 is a 433 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AGCTACTCAGCACGTGCCTATTATCCTCAC; Right flanking sequence: GCTGGTTTGGGAGTGGCGCCGCATGTTGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5023 C. elegans C45G3.3(gk5549[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5549 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4477 and CGC92. gk5549 is a 1227 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGTTTTGAACGCTCGCGCCACAATGTCATA; Right flanking sequence: ATTTTCCCTTGTTCTCTTGCTCACAGTAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5024 C. elegans cox-7C(gk5632[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5632 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4561 and CGC92. gk5632 is a 1065 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACATCAAAGTCAGAGTTTTATGGCTCACCG; Right flanking sequence: GGGGCTTGTAAGATGAGAAGCACCCGTTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5025 C. elegans F26E4.4(gk5646[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5646 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4575 and CGC92. gk5646 is a 1524 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAAAAAAACTGGATAACAATAAATTGGCAA; Right flanking sequence: TGGAAAACGCACGCGACGCGTGACCGCAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5027 C. elegans pbs-7(gk5705[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5705 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4636 and CGC92. gk5705 is a 737 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAACATGGAGATACTGAAACGCATCCTGCA; Right flanking sequence: TCAGCTGAACGGAAATTCAAACCTTGTAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5028 C. elegans ZC434.4(gk5836[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5836 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4768 and CGC92. gk5836 is a 1235 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CTCCATTCTTGATATGCAATGTTTTTTAAA; Right flanking sequence: TGGGCTAAGAGTTCCGATGCACCCTCGGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5030 C. elegans gfi-2(gk5771[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5771 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4702 and CGC92. gk5771 is a 2938 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAGAAACTTCATCAATATCAATGAATCTGC; Right flanking sequence: TCACTCCTGGGTACTGAGTACCTTGACGAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5031 C. elegans +/mT1 [umnIs52] II; tftc-5(gk5467[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5467 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4389 and CGC66. gk5467 is a 2935 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCTCGTATTATGGCGGAACGGAAACCTCAG; Right flanking sequence: GCAATGAATGAGCTAGTGGCTGTTGTAGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5032 C. elegans +/mT1 [umnIs52] II; C14B9.10(gk5476[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5476 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4398 and CGC66. gk5476 is a 1853 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GACCAAACCGTCAGACATGCTGCGTCTCCT; Right flanking sequence: AACTGGCAAGAAATGGTTCCGCATTGTGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5033 C. elegans +/mT1 [umnIs52] II; F45G2.10(gk5482[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5482 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4404 and CGC66. gk5482 is a 2468 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTTAAACACGTTTTTATTCGAAACCTGAT. Right flanking sequence: GCTGGAAATGGAAAATGACGAAAAAATATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5034 C. elegans +/mT1 [umnIs52] II; mrps-18C(gk5520[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5520 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4445 and CGC66. gk5520 is a 1322 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAGGTCGCAGAAGAACATTGACCCCAGCTC; Right flanking sequence: GAAGAGATAAAACGAAAGCTAAGATTGCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5035 C. elegans +/mT1 [umnIs52] II; C16C10.2(gk5524[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5524 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4449 and CGC66. gk5524 is a 957 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TAACTACTTCTTTCGTTCATAGGTCCATTT. Right flanking sequence: CGAGGACATGGCTGGCTGAAAATAATTTTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5036 C. elegans +/mT1 [umnIs52] II; gop-2(gk5528[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5528 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4453 and CGC66. gk5528 is a 1052 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence:CTATTTTCAGCGTCTCACAGCATTCCTACA ; Right flanking sequence: GAATTTCTGGAGTCGGAGTTGAATTCAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5037 C. elegans +/mT1 [umnIs52] II; C16A3.6(gk5536[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5536 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VCVC4462 and CGC66. gk5536 is a 1237 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGAAAGATGAAAATAGAGAGAAGGCGCCT; Right flanking sequence: CAAAGGGTCAAGGCATAAAACTTCGCATTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5038 C. elegans +/mT1 [umnIs52] II; Y37D8A.16(gk5539[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5539 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4466 and CGC66. gk5539 is a 2739 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAAACGCAATTATAAGATCCCTTCGAGATA; Right flanking sequence: GTATACAGTTCCGGTGCATGACTAATGTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5039 C. elegans lat-1(gk5420[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [umnIs52] II; +/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5420 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4337 and CGC66. gk5420 is a 11293 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CTCTCCTCTATGCTTTCTCTAGTTTTGCCT; Right flanking sequence: GACGGTGCTTCGAATTGATTTGAACAAGCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5041 C. elegans +/mT1 [umnIs52] II; unc-116(gk5722[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5722 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4653 and CGC66. gk5722 is a 2264 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCTTTGAAATGACGGATTTTTGGACCACAT; Right flanking sequence: CCCGGCTTCTCCTTACAATGCCTGCAATAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5042 C. elegans +/mT1 [umnIs52] II; lars-1(gk5763[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5763 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4694 and CGC66. gk5763 is a 5294 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GACGTTAGCCTTGTACACAATAGTACGCCC; Right flanking sequence: TGGCCTAGTTTTGCAATGGCATCGACCGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5043 C. elegans kars-1(gk5813[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [umnIs52] II; +/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5813 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4745 and CGC66. gk5813 is a 2292 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGAGAGAAAAGCAATAGAGGGGTCTCGCCG; Right flanking sequence: CGGAATTATGGACAAAAAGCGAAAAATCTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5044 C. elegans gex-3(gk5235[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 [umnIs49] IV; +/ nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5235 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4152 and CGC63. gk5235 is a 2546 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTCGACGTTCGAATATGTACAAGAAAAGTC; Right flanking sequence: TGCTTCATCTGGTCATATGGTTTGGAGTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5045 C. elegans +/nT1 [umnIs49] IV; vha-13(gk5758[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5758 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4759 and CGC63. gk5758 is a 2243 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTCCAGGAAAAGATGGCCGCAGAATCTTCG; Right flanking sequence: CGCTAGATTCTGTTCAGTTTTGCTGAGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5046 C. elegans iars-1(gk5827[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5827 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4759 and CGC63. gk5827 is a 3755 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CCGTTCCCGACAACATCAATTTTGCCAGAG; Right flanking sequence: GGCGGTCCATCCAACAGTTGACGTGACGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5047 C. elegans +/ nT1 [umnIs49] IV; vars-1(gk5828[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5828 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4760 and CGC63. gk5828 is a 3391 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGTTTGACAAAAAAATATTTTTTAATCTTC; Right flanking sequence: AGGAACAGTTTCAAGCAAGAATTGCATCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5048 C. elegans +/mT1 [umnIs52] II; tost-1(gk5543[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5543 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4470 and CGC66. gk5543 is a 1358 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGTTTTATGCACCTCCGTATCACACCACCA; Right flanking sequence: TGTTGCTGTGCTCACGGTCAGCTAAAGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5050 C. elegans +/mT1 [umnIs52] II; C35D10.5(gk5552[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5552 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4480 and CGC66. gk5552 is a 1321 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAGAAAACCGAAAAATGTTCTCGTTGCTCC; Right flanking sequence: ATTGTTTATACGCGTGTTTCTCTCCACTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5053 C. elegans +/mT1 [umnIs52] II; C36A4.4(gk5562[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5562 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4490 and CGC66. gk5562 is a 1777 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGAAGACGTCGAAAATAAACTGCTCCAGCT; Right flanking sequence: GGTGGAAAACAATTCAAAAAGTGATAATAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5054 C. elegans +/mT1 [umnIs52] II; : nlp-48(gk5563[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5563 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4491 and CGC66. gk5563 is a 1026 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCAAATGGTAAGTTCTTACATAGGCCCCAG; Right flanking sequence: CGTGGATTTTAATATTAAAGTATCGTCCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5056 C. elegans +/mT1 [umnIs52] II; idhg-1(gk5648[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5648 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4577 and CGC66. gk5648 is a 2420 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAAACACGTGCGGCGCTTGCAAATCAATCG; Right flanking sequence: TTACGTTCTTTTCCTCTGTTTTTTTTTCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5059 C. elegans '+/mT1 [umnIs52] II; famh-136(hd7024[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick wild-type GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7024 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7027 and CGC66. hd7024 is a 542 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTTGAGCTTTAGCTATCTTCCTTTATCCT; Right flanking sequence: ATCACAGGTGTGAAGATTTATTAAATTTTA. sgRNA #1: ATGAATGACGCAAGAATTAA; sgRNA #2: TCTGAATACTTATTGACATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.