Search Strains

Transformation of ray 6 to a thin ray which is anteriorly displaced and fuses with ray 4 (95%). A 10th ray is found in about 50% of the sides scored. Body is slightly shorter. Do not distribute this strain; other labs should request it from the CGC.

syEx1341 [ges-1p::fars-1(T412G)::fib-1::rps-16::GFP(S65C, SynIVS)::unc-54 3' UTR + myo-2p::DsRed::unc-54 3' UTR + pha-1(+) + pBluescript]. GFP expression in the intestine. Maintain at 25C and pick animals with red fluorescence in pharynx. Expresses a phenylalanyl-tRNA capable of tagging proteins with the non-canonical amino acid p-azido-L-phenylalanine in the intestine. Reference: Yuet KP, et al. Proc Natl Acad Sci U S A. 2015 Mar 3;112(9):2705-10.

syEx1342 [myo-2p::fars-1(T412G)::fib-1::rps-16::GFP(S65C, SynIVS)::unc-54 3' UTR + unc-122p::mCherry::unc-54 3' UTR + pha-1(+) + pBluescript]. GFP expression in the pharynx. Maintain at 25C and pick animals with red fluorescence in coelomocytes. Expresses a phenylalanyl-tRNA capable of tagging proteins with the non-canonical amino acid p-azido-L-phenylalanine in pharyngeal muscle. Reference: Yuet KP, et al. Proc Natl Acad Sci U S A. 2015 Mar 3;112(9):2705-10.

syEx1343 [myo-3p::fars-1(T412G)::fib-1::rps-16::GFP(S65C, SynIVS)::unc-54 3' UTR + myo-2p::DsRed::unc-54 3' UTR + pha-1(+) + pBluescript]. GFP expression in body wall muscle. Maintain at 25C and pick animals with red fluorescence in pharynx. Expresses a phenylalanyl-tRNA capable of tagging proteins with the non-canonical amino acid p-azido-L-phenylalanine in body wall muscle. Reference: Yuet KP, et al. Proc Natl Acad Sci U S A. 2015 Mar 3;112(9):2705-10.

syEx1344 [rab-3p::fars-1(T412G)::fib-1::rps-16::GFP(S65C, SynIVS)::unc-54 3' UTR + myo-2p::DsRed + pha-1(+) + pBluescript]. GFP expression in neurons. Maintain at 25C and pick animals with red fluorescence in pharynx. Expresses a phenylalanyl-tRNA capable of tagging proteins with the non-canonical amino acid p-azido-L-phenylalanine in neurons. Reference: Yuet KP, et al. Proc Natl Acad Sci U S A. 2015 Mar 3;112(9):2705-10.

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-28. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAGCTTAAATATTCAACTGGAACCTTCTCCTGGCG right flanking sequence: AGATGGAGAAAAGATATGAAGCTGAGgtatgtttttc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGAACCTTCTCCTGGCGAGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of seb-3 in him-5(e1490) background. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GAATTGAAAAAACTGGAAAACAGTTCGTATAATCCG right flanking sequence: GGgtgggtcaagttccagtgttcagtttttttaaag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACAGTTCGTATAATCCGGGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of str-74 in him-5(e1490) background. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGGAATATTGTTTTCGGGAATAGAAATCCTTGC right flanking sequence: CAGACCATTCGCTCATAATTATAACAACAGTTTGATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TATGAGCGAATGGTCTGGCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-49 into parental strain CB4088. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GCTGCTTTTGGCTGTTTTCTGCATTGCTGCCTAT. Right flanking sequence: CCTGGGCTGATGGGgtatgttccaatattgaacc. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTGCATTGCTGCCTATGCCT Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Lineage defects in B, F & U blast cells resulting in abnormal spicules and ectopic spicule cells. F34D10.5 rescues lin-48(sy234); it encodes a C2H2 zinc finger protein similar to Drosophila ovo. Do not distribute this strain; other labs should request it from the CGC.

Him.

Spermatogenesis abnormal with small brood size. PKD-2::GFP ciliary localization defective. Maintain at 20 C. inpp-5K formerly known as cil-1. Reference: Bae Y, et al. 2009 Curr Bio 19(19):1599-607.

Defective in male sex drive regulation. Reference: Nat Neurosci. 2012 Dec;15(12):1675-82.

Male leaving assay defective (Las), lethargic, hypereversal. Reference: Barrios, A, et al. Nat Neurosci. 2012 Dec;15(12):1675-82.

myEx741 [pdfr-1p(3kb)::NLS::RFP + unc-122::GFP]. Him. Pick RFP+ and GFP+ to maintain. Reference: Barrios A, et al. Nat Neurosci. 2012 Dec;15(12):1675-82.

cil-7(tm5848) is an out-of-frame deletion. Him. Reference: Maguire JE, et al. Mol Biol Cell. 2015 Aug 1;26(15):2823-32. doi: 10.1091/mbc.E15-01-0009. Epub 2015 Jun 3. PMID: 26041936.

cil-7(tm5848) is an out-of-frame deletion. Him. Reference: Maguire JE, et al. Mol Biol Cell. 2015 Aug 1;26(15):2823-32. doi: 10.1091/mbc.E15-01-0009. Epub 2015 Jun 3. PMID: 26041936.

mNeonGreen tag inserted into endogenous nekl-4 locus by CRISPR/Cas9 engineering. Very faint mNeonGreen expression in the dendrites, soma, and axons of all ciliated neurons. Reference: Power KM, et al. PLoS Genet. 2020 Oct 16;16(10):e1009052. PMID: 33064774

myIs4 [pkd-2p::pkd-2::GFP + unc-122p::GFP]. Phenotypically normal. sid-2::mScarlet is functional in environmental RNAi. Reference: Nikonorova IA, et al. Curr Biol. 2022 Mar 19;S0960-9822(22)00396-7. PMID: 35334227

Males Lov and response defective. Mislocalizes pkd-2::GFP in cilia. sy511 contains a nonsense mutation in exon 10 (C-T transition = Q706stop).

Superficially WT.

Superficially WT.

Males are response and location-of-vulva defective. pkd-2(sy606) is a 2396 bp deletion (8388 to 5942 in YAC Y73F8A); mutant protein is predicted to contain the N-terminal portion of the protein midway through the first predicted transmembrane region.

Male mating response defect.

fxDf1 (II: 2,484,339 - 2,487,244) removes nspf-1, nspf-2, and nspf-3. Him. This strain carries a knockout of the Nematode-Specific Peptide family, group F (NSPF) gene family, which localizes to sperm membranous organelles. There are no effects on spermatogenesis, male fertility, or sperm competitive ability. Hermaphrodites produce approximately 30% males. Reference: Kasimatis KR, et al. (2018) BioRxiv 290221; doi: https://doi.org/10.1101/290221.

fxIs1 [pie-1p::TIR1::mRuby, I:2851009] I. Auxin-inducible spermatogenesis arrest, resulting in hermaphrodite self-sterility and reversible male sterility. Him: males produced at ~30%. AID* tag was inserted into the endogenous spe-44 locus. Reference: Kasimatis KR, et al. (2018) Auxin-Mediated Sterility Induction System for Longevity and Mating Studies in Caenorhabditis elegans. BioRvix. doi: https://doi.org/10.1101/284232.

rdIs26 [R08E3.4::GFP + unc-119(+)]. Construct contains ~5 kb upstream of R08E3.4A. Superficially wild-type. Reference: Large and Mathies (2010) Dev Biol 339(1):51-64.

rdIs27 [R08E3.4::GFP + unc-119(+)]. Construct contains ~5 kb upstream of R08E3.4A. Superficially wild-type. Reference: Large and Mathies (2010) Dev Biol 339(1):51-64.

T03F1.2. Homozygous. Outer Left Sequence: ATGAAGTTGTCAAGGCCACC. Outer Right Sequence: CGTTTCAATGAGCCTGGAGT. Inner Left Sequence: ATTGGAGGAGGTGACACTGC. Inner Right Sequence: AGAGTTGAAGAGAATGCGGC. Inner Primer PCR Length: 2182 bp. Deletion Size: 1210 bp. Deletion left flank: AACACACGACTTCACCCACATCGCATTGGA. Deletion right flank: TTTAGCACGTGTCTCAGCTTCTGCCGCATT. Insertion Sequence: CG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F47A4.3 Homozygous. Outer Left Sequence: gactggctcgagaagattcg. Outer Right Sequence: tgtagatccgcaaaatgcac. Inner Left Sequence: tgtttgtggctggaaattga. Inner Right Sequence: gtatcaacgtgcctttggct. Inner Primer PCR Length: 3357. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y48E1A.1. Homozygous. Outer Left Sequence: TTCAGCTTTGAAATTTCCGC. Outer Right Sequence: GCCATTTTGGGCAATAAAAA. Inner Left Sequence: CTCCGTCGTCTGATCCTCTC. Inner Right Sequence: TTCAGGAATGAGATCCCTCG. Inner Primer PCR Length: 2607 bp. Deletion Size: 1490 bp. Deletion left flank: CAGTTTCAATTCCCGCTGCCATATTTCCCT. Deletion right flank: TTTTGTCTCAGAAAATCCGCATTTTTTGCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Larval arrest. Deletion of 1490 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae, (ve947 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tctgttcatcatgtttcacgtggatgagag; Right flanking sequence: CGGCAACTCCTGGAGTATTGACGACGTCGT. mdh-2 sgRNA A: ggaagagacacagacagcgc; mdh-2 sgRNA B: ATCAATGTGCGAAAGATCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

ynIs34 [flp-19p::GFP] IV. Him. Transcriptional flp-19 reporter. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785. Clark SG & Chiu C. Development. 2003 Aug;130(16):3781-94. Kim K & Li C. J Comp Neurol. 2004 Aug 2;475(4):540-50.

gaIs259 [R09H10.3p::his-24::mCherry + unc-119(+)]. Published in Liu, X., et al., Cell, 2009. 139(6).

ebEx126 [YAC Y47H9 [spe-9(+)] + rol-6(su1006)]. Pick Rollers to maintain. eb19 is a spe-9 non-conditional mutant.

Hermaphrodites are sluggish and exhibit protruding vulva, ruptured vulva, or internally hatched progeny. Males move slower than WT and have disorganized tail rays.

Hermaphrodites are sluggish and exhibit protruding vulva, ruptured vulva, or internally hatched progeny. Males move slower than WT and have disorganized tail rays.

Hermaphrodites seem fine. Males have a high penetrance of anterior displacement of ray 1.

NeuroPAL landmark reporter in a sextuple CUT mutant background. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). otDf1 is a deletion affecting ceh-41, ceh-21, T26C11.9, and ceh-39. Reporter expression is affected in this mutant, suggesting alterations in neuronal identity.

Animals with the Duplication are WT. Animals which have lost the Duplication are Unc. Throws males.

ncIs3 [pH20::GFP + pBlueScript]. Expresses GFP in nearly all neurons. No morphological or behavioral phenotypes.

Various epidermal defects. In male tails, ray 1 is dislocated anteriorly.

uIs71 [(pCFJ90) myo-2p::mCherry + mec-18p::sid-1]. TRN-specific RNAi by feeding. Him (~50% males). Maintain 15-20 degrees. Reference: Calixto et al. (2010) Nature Methods 7:554-9.

uIs72 [pCFJ90(myo-2p::mCherry) + unc-119p::sid-1 + mec-18p::mec-18::GFP]. Hypersensitive neuronal RNAi by feeding. GFP detectable in TRNs. Him (~50% males). Maintain 15-20 degrees. Reference: Chalfie (2010) Worm Breeders Gazette.

Him. Enhanced RNAi background. Maintain under normal conditions.

Him strain. Superficially wild-type. References: Portman and Emmons Dev Bio (2004) & Miller and Portman Mod & Mech (2010).

Him strain. Superficially wild-type. References: Portman and Emmons Dev Bio (2004) & Miller and Prtman Mod & Mech (2010).

Him strain. Superficially wild-type. Males have mating (response) defect but are fertile; otherwise superficially wild-type. Reference: Miller and Prtman Mod & Mech (2010).