| temp_name36 |
|
daf-18(e1375) dpy-9(e12) IV. Show Description
Does not contain e1375. May have a different daf mutation.
|
|
| temp_name370 |
|
slx-1(tm2644) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); him-6(ok412) IV. Show Description
TG need to confirm genotype/phenotype - don't send
|
|
| temp_name44 |
|
spe-12(hc149) dpy-5(e61) IV. Show Description
Could not get to grow. Removed 4/29/02
|
|
| temp_name5 |
|
unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m322) let-?(m360)IV. Show Description
LAB
|
|
| temp_name58 |
|
C01G5.2(gk50) IV. Show Description
mutation not present-Mark Edgley 4/03
|
|
| temp_name6 |
|
unc-17(e113) dpy-13(e184)IV; mDp2(IV;?). Show Description
CGC
|
|
| temp_name79 |
|
pik-1(nr2019) IV. Show Description
J Ewbank-no mutation present
|
|
| temp_name8 |
|
unc-22(s7) unc-31(e169) let-302(s1159)/nT1 IV; +/nT1 V. Show Description
CGC
|
|
| temp_name88 |
|
mbk-2(pk1427)/mgIs18 IV. Show Description
Removed 12/05: never recovered
|
|
| temp_name92 |
|
dpy-20(e1282) IV; [tax-4::GFP + dpy-20(+)]. Show Description
Removed 12/05. Not correct??
|
|
| TG1568 |
C. elegans |
fan-1(tm423) IV. Show Description
411 bp deletion removes exons 6-8. Homozygotes are viable, but are hypersensitive to DNA crosslinking.
|
|
| TG1749 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; gtIs60. Show Description
gtIs60 [pie-1p::GFP(lap)::orc-1 + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Reference: Sonneville R, et al. J Cell Biol. 2012 Jan 23;196(2):233-46.
|
|
| TG1750 |
C. elegans |
unc-119(ed3) III; ltIs37 IV, gtIs61. Show Description
gtIs61 [pie-1p::GFP(lap)::orc-2 + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Reference: Sonneville R, et al. J Cell Biol. 2012 Jan 23;196(2):233-46.
|
|
| TG1751 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; gtIs62. Show Description
gtIs62 [pie-1p::GFP(lap)::cdc-6 + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Reference: Sonneville R, et al. J Cell Biol. 2012 Jan 23;196(2):233-46.
|
|
| TG1753 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; gtIs64. Show Description
gtIs64 [pie-1p::GFP(lap)::mcm-3 + unc-119(+)]. ltIs37 [(pie-1p::mCherry::his-58 + unc-119(+)] IV. Reference: Sonneville R, et al. J Cell Biol. 2012 Jan 23;196(2):233-46.
|
|
| TG1754 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; gtIs65. Show Description
gtIs65 [pie-1p::GFP(lap)::cdc-45 + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Reference: Sonneville R, et al. J Cell Biol. 2012 Jan 23;196(2):233-46.
|
|
| TG1755 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; gtIs66. Show Description
gtIs66 [pie-1p::GFP(lap)::div-1 + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Reference: Sonneville R, et al. J Cell Biol. 2012 Jan 23;196(2):233-46.
|
|
| TG1756 |
C. elegans |
unc-119(ed3) III; ltIs37 IV. gtIs67. Show Description
gtIs67 [pie-1p::GFP(lap)::sld-5 + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Reference: Sonneville R, et al. J Cell Biol. 2012 Jan 23;196(2):233-46.
|
|
| TG1975 |
C. elegans |
slx-1(tm2644) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); him-6(ok412) IV. Show Description
Him. Heterozygotes are WT. Segregates WT GFP+ heterozygotes, non-GFP slx-1 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+ to retain balanced strain: 15-25% of slx-1(tm2644) homozygotes are viable. Reference: Agostinho A, et al. PLos Genetics 2013.
|
|
| TG2196 |
C. elegans |
him-6(ok412) spo-11(me44) IV/nT1 (IV;V). Show Description
Him. Heterozygotes are WT and segregate WT, Vul and dead eggs. Maintain by picking WT. Reference: Agostinho A, et al. PLos Genetics 2013.
|
|
| TG2226 |
C. elegans |
xpc-1(tm3886) IV. Show Description
Superficially wild-type. Deletion site verified by PCR. Reference: Meier B, et al. Genome Res. 2014 Oct;24(10):1624-36.
|
|
| TG2368 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; gtIs2368. Show Description
gtIs2368 [pie-1p::GFP(lap)::rpa-1 + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Reference: Sonneville R, et al. J Cell Biol. 2012 Jan 23;196(2):233-46.
|
|
| TG2932 |
C. elegans |
tdpo-1(gk889420) IV. Show Description
Superficially wild-type. Deletion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169.
|
|
| TG3867 |
C. elegans |
xpg-1(tm1670) I. Show Description
Superficially wild-type. Deletion site verified by PCR. Reference: Meier B, et al. 2020 bioRxiv, https://doi.org/10.1101/2020.06.04.133306
|
|
| TG4094 |
C. elegans |
unc-119(ed3) III; cxTi10816 IV; otIs433 V; gtEx4094. Show Description
otIs433 [dat-1::NLS::RFP + ttx-3::mCherry] V. gtEx4094 [glit-1p::GFP::glit-1 3'UTR + myo-3p::mCherry]. Pick animals with red fluorescence in body muscles to maintain. Transcriptional glit-1 reporter. Reference: Offenburger SL, et al. https://www.biorxiv.org/content/early/2017/10/13/203067.
|
|
| TG4100 |
C. elegans |
vtIs1 V; glit-1(gt1981) X. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Strain does not roll obviously. gt1981 is a point mutation in a highly conserved residue. Hypersensitive to oxidative stress: Increased dopaminergic neurodegeneration after 6-OHDA exposure and increased developmental delay after exposure to rotenone and paraquat. Reference: Offenburger SL, et al. https://www.biorxiv.org/content/early/2017/10/13/203067.
|
|
| TG4103 |
C. elegans |
ttr-33(gt1983) vtIs1 V. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Strain does not roll obviously. Hypersensitive to oxidative stress: Increased dopaminergic neurodegeneration after 6-OHDA exposure and increased developmental delay after exposure to rotenone and paraquat. Reference: Offenburger SL, et al. https://www.biorxiv.org/content/early/2017/10/13/198606.
|
|
| TG4281 |
C. elegans |
unc-119(ed3) III; cxTi10816 IV; gtEx4170. Show Description
gtEx4170 [ttr-33p::GFP::ttr-33 3'UTR + myo-2p::mCherry + myo-3p::mCherry]. Pick mCherry+ animals to maintain. Transcriptional ttr-33 reporter. Reference: Offenburger SL, et al. https://www.biorxiv.org/content/early/2017/10/13/198606.
|
|
| TG5 |
C. elegans |
rad-51(lg8701) IV/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are WT and segregate WT and dead eggs. 1/3 of the WT are rad-51(lg8701) homozygotes and will give only dead eggs.
|
|
| TG9 |
C. elegans |
dpy-13(e184) rad-51(lg8701) IV/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are WT and segregate WT, Dpys which give only dead eggs, and dead eggs.
|
|
| TH11 |
C. elegans |
unc-5(e53) dpy-20(e1282) IV. Show Description
Unc. ts Dpy.
|
|
| TH112 |
C. elegans |
let-99(dd17) IV/nT1 [qIs51] (IV;V). Show Description
let-99(dd17) contains a 647bp deletion with the flanking sequences aatttttaggaagtttccagaaatttttcc / CAAGGCTCCCACGAAGATTATCGCGATCTA. The deletion removes the N terminus of the open reading frame including the start codon and the DEP domain. Heterozygotes are GFP+ in the pharynx. dd17 is a maternal effect lethal mutation.
|
|
| TH113 |
C. elegans |
let-99(dd18) IV/nT1 [qIs51] (IV;V). Show Description
let-99(dd18) contains a 1039bp deletion with the flanking sequences TTTGGATGAGTTGAAGCATCCCAAGCCCCG / ATGAATGCTCTCTTATTGTTAATCTCCTCT. The deletion starts behind the DEP domain. Heterozygotes are GFP+ in the pharynx. dd18 is a maternal effect lethal mutation.
|
|
| TH48 |
C. elegans |
mbk-2(dd5) IV. Show Description
Recessive temperature sensitive maternal effect lethal. Maintain at 15C. At 16C: dd5 animals produce 90% viable embryos. At 20C: dd5 animals produce 56% viable embryos. At 25C: dd5 animals produce 2% viable embryos.
|
|
| TJ356 |
C. elegans |
zIs356 IV. Show Description
zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)]. Daf-c, Rol, Fluorescent DAF-16::GFP, Age, increased resistance to heat and UV. Grows and reproduces slowly. Maintain at 20C. Integrated by gamma irradiation of extrachromosomal (Ex daf-16::GFP) line. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. April 2005: Corrigendum: daf-16 integrates developmental and environmental inputs to mediate aging in the nematode Caenorhabditis elegans. Joshua McElwee of University College London has brought to our attention that plasmid pGP30 described in Henderson and Johnson (Current Biology 11, 1975-1980, December 2001) contains a mutation. We have confirmed the mutation in our own traces from the original sequence. Using daf-16a2 cDNA as a reference sequence (genbank accession number AF020343), pGP30 contains an A to T transversion at AF020343 position 1747:(TTCCCGATCAGCCACTGATGG(a/t)ACTATGGATGTTGATGCATTGA). This mutation results in an GAT (asp) to GTT(val) change at position 484 of the translated AF020343 sequence. The DAF-16::GFP (green fluorescent protein) protein encoded by pGP30 rescues a daf-16 null phenotype and behaves similarly to other reported DAF-16 fusion constructs (Lee et al., 2001; Lin et al., 2001). Therefore, we do not feel it alters the conclusions of the paper. We regret any inconvenience this may have caused. Samuel T. Henderson* and Thomas E. Johnson². ²Correspondence: johnsont@colorado.edu. Lee, R. Y., Hench, J., and Ruvkun, G. (2001). Regulation of C. elegans DAF-16 and its human ortholog FKHRL1 by the daf-2 insulin-like signaling pathway. Curr Biol 11, 1950-1957.Lin, K., Hsin, H., Libina, N., and Kenyon, C. (2001). Regulation of the Caenorhabditis elegans longevity protein DAF-16 by insulin/IGF-1 and germline signaling. Nat Genet 28, 139-145. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| TN101 |
C. elegans |
cha-1(cn101) IV. Show Description
|
|
| TN142 |
C. elegans |
dpy-20(cn142) IV. Show Description
Recessive Dpy. Rounded head. Reduced brood size
|
|
| TN145 |
C. elegans |
him-8(e1489) IV; adt-1(cn30) X. Show Description
Morphological changes in the rays, especially transformation of ray 6 into a thickened shape. Appearance of abnormal protuberances around rays. Closed structure of the fan. Impaired mating ability. Exons 8-10 of the adt-1 gene, encoding most of the metalloproteinase domain of ADT-1, are deleted in adt-1(cn30).
|
|
| TN322 |
C. elegans |
dpy-20(cn322) IV. Show Description
Recessive Dpy. Rounded head.
|
|
| TN326 |
C. elegans |
dpy-20(cn326) IV. Show Description
Recessive Dpy. Rounded head. Reduced brood size.
|
|
| TQ10515 |
C. elegans |
seld-1(xu408) IV. Show Description
seld-1(xu408) is a G314E missense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443
|
|
| TQ10517 |
C. elegans |
gspd-1(xu416) IV. Show Description
gspd-1(xu416) is a E375K missense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443
|
|
| TQ10518 |
C. elegans |
gspd-1(xu409) IV. Show Description
gspd-1(xu409) is a L369F missense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443
|
|
| TQ10520 |
C. elegans |
seld-1(xu415) IV. Show Description
seld-1(xu415) is a G170E missense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443
|
|
| TQ10548 |
C. elegans |
trxr-1(xu421) IV. Show Description
trxr-1(xu421) is a W275* nonsense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443
|
|
| TQ233 |
C. elegans |
trpa-1(ok999) IV. Show Description
Shorter lifespan than wild-type worms at 15-20 C, but not at 25 C. Reference: Xiao R, et al. Cell. 2013 Feb 14;152(4):806-17.
|
|
| TR1696 |
C. elegans |
unc-54(r293) I; smg-3(r930) IV. Show Description
P-vul.
|
|
| TR2230 |
C. elegans |
unc-54(r293) I; smg-7(r1197) IV. Show Description
P-Vul. WT movement.
|
|
| TS465 |
C. elegans |
nca-2(gk5) III; unc-77(gk9) IV; lin-15B&lin-15A(n765) X; vaIs41. Show Description
vaIs41 [nca-2::GFP + lin-15(+)]. Superficially Wild-type.
|
|
| TS469 |
C. elegans |
nca-2(gk5) III; unc-77(gk9) IV; lin-15B&lin-15A(n765) X; vaIs46. Show Description
vaIs46 [nca-1::GFP + lin-15(+)]. Superficially Wild-type.
|
|