Strain Information
| Name | TH113 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | let-99(dd18) IV/nT1 [qIs51] (IV;V). |
| Description | let-99(dd18) contains a 1039bp deletion with the flanking sequences TTTGGATGAGTTGAAGCATCCCAAGCCCCG / ATGAATGCTCTCTTATTGTTAATCTCCTCT. The deletion starts behind the DEP domain. Heterozygotes are GFP+ in the pharynx. dd18 is a maternal effect lethal mutation. |
| Mutagen | EMS |
| Outcrossed | x5 |
| Made by | Henrik Bringmann |
| Laboratory | TH |
Sign in
or
register an account if you want to order this strain.