Strain Information

Name TH113   View On Wormbase
Species C. elegans
Genotypelet-99(dd18) IV/nT1 [qIs51] (IV;V).
Descriptionlet-99(dd18) contains a 1039bp deletion with the flanking sequences TTTGGATGAGTTGAAGCATCCCAAGCCCCG / ATGAATGCTCTCTTATTGTTAATCTCCTCT. The deletion starts behind the DEP domain. Heterozygotes are GFP+ in the pharynx. dd18 is a maternal effect lethal mutation.
MutagenEMS
Outcrossedx5
Made byHenrik Bringmann
Laboratory TH
Sign in or register an account if you want to order this strain.