Search Strains

Worms are viable at 15C and dead at 24C.

Hermaphrodites are sluggish and exhibit protruding vulva, ruptured vulva, or internally hatched progeny. Males move slower than WT and have disorganized tail rays.

Hermaphrodites are sluggish and exhibit protruding vulva, ruptured vulva, or internally hatched progeny. Males move slower than WT and have disorganized tail rays.

Hermaphrodites seem fine. Males have a high penetrance of anterior displacement of ray 1.

NeuroPAL landmark reporter in a sextuple CUT mutant background. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). otDf1 is a deletion affecting ceh-41, ceh-21, T26C11.9, and ceh-39. Reporter expression is affected in this mutant, suggesting alterations in neuronal identity.

Class IV supersized lipid droplet mutant. GCT-->GTT mutation. 5' flanking sequence: agatccaaatgcaaaggttg. 3' flanking sequence: ttgcgagaccgtaacaaaaa

sams-1 (a.k.a.- drop-4) Class IV supersized lipid droplet mutant. GCT-->GTT mutation. 5' flanking sequence: agatccaaatgcaaaggttg. 3' flanking sequence: ttgcgagaccgtaacaaaaa References: Li S, et al. G3 (Bethesda). 2016 Aug 9;6(8):2407-19. Li S, et al. Proc Natl Acad Sci U S A. 2017 Aug 15;114(33):8841-8846.

DpyUnc.

Defective in FITC dye filling.

Defective in dye filling (FITC or DiO) of amphid and phasmid neurons. Chemotaxis defective.

Animals with mnDp90 are WT. Animals which have lost mnDp90 are DpyUnc and Ncl. Throws males. Males containing mnDp90 are fertile. mnDp90 was derived from mnDp86.

Segregates Unc and WT. Maintain by picking WT.

Blistered cuticle. Dominant.

Hypersensitive to UV, not to X irradiation or MMS. Reduced brood size.

Homozygous WT.

Unc. Contains Tc4 insertion in the unc-33 gene. Easily reverts -- pick Unc to maintain.

dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. Sma. Dominant allele of skn-1 is constitutively active and does not respond to dietary restriction. Reference: Paek J, et al. Cell Metab. 2012 Oct 3;16(4):526-37.

dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. Sma. Dominant allele of skn-1 is constitutively active and does not respond to dietary restriction. Reference: Paek J, et al. Cell Metab. 2012 Oct 3;16(4):526-37.

Temperature sensitive sterility. The sterility has both a maternal and a non-maternal component. Can be maintained indefinitely at low temperatures (16-23 C), with 7-19% sterile offspring. When low-temperature-grown homozygotes are allowed to produce progeny at 25C, the percentage of sterile offspring is 75-85%; at 26C the percentage of sterile offspring is 100%. Throws males.

Heterozygotes are Unc (n754 is a dominant Unc and recessive lethal). Throws DpyUncs which give sterile progeny. The maternal effect sterility is 99% expressed, 100% strict, and is associated with 2% maternal effect embryonic lethality.

Heterozygotes are Unc (n754 is dominant Unc and recessive lethal). Hets throw Dpys which give only sterile progeny. The maternal effect sterility is 99% expressed, 100% strict, and is associated with 1% maternal effect embryonic lethality.

Temperature sensitive sterility. The sterility has both a maternal and a non-maternal component. Can be maintained indefinitely at low temperatures (16-23 C), with 7-19% sterile offspring. When low-temperature-grown homozygotes are allowed to produce progeny at 25C, the percentage of sterile offspring is 75-85%; at 26C the percentage of sterile offspring is 100%.

Temperature sensitive sterility. The sterility has both a maternal and a non-maternal component. Can be maintained indefinitely at low temperatures (16-23 C), with 7-19% sterile offspring. When low-temperature-grown homozygotes are allowed to produce progeny at 25C, the percentage of sterile offspring is 75-85%; at 26C the percentage of sterile offspring is 100%.

Dpy Unc. Temperature sensitive. Maintain at 15C. Grows very slowly.

Throws males. Dpy. Unc. Mostly sterile at all temperatures, but a small fraction are fertile at low temperatures. Maintain at 15C.

Throws males. Mostly sterile at all temperatures, but a small fraction are fertile at low temperatures. Maintain at 15C.

Throws males. Maintain at 15C. Sterile at higher temperatures.

Unc. Maintain at 15C. Sterile at higher temperatures.

Dpy. Unc. Mostly sterile at all temperatures, but a small fraction are fertile at low temperatures. Maintain at 15C.

Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP, arrested nT1[qIs51] aneuploids, and non-GFP iow1 homozygotes (viable; see note below). Homozygous nT1[qIs51] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. iow1 is a separation-of-function allele of mre-11. Homozygotes develop into adults wild-type in appearance, but laying dead eggs due to defects in meiotic DSB repair: mre-11(iow1) worms form meiotic DSBs but are impaired in their resection. Pick GFP+ to maintain (mre-11(iow1)/nT1[qIs51]) and GFP- to obtain homozygous mre-11(iow1) worms for analysis. Reference: Yin Y & Smolikove S. Mol Cell Biol. 2013 Jul;33(14):2732-47. doi: 10.1128/MCB.00055-13. Epub 2013 May 13. Erratum in: Mol Cell Biol. 2015 Jul;35(14):2568. PubMed PMID: 23671188; PubMed Central PMCID: PMC3700128.

Heterozygotes are wild-type with pharyngeal-expressed GFP, and segregate wild-type GFP+(pharynx) heterozygotes, arrested nT1[qIs51] homozygotes, and viable non-GFP(pharynx) rad-51(iow53[GFP::rad-51]) homozygotes. Balancer is prone to breaking down. If a population contains a mix of bright and dim GFP animals, pick dim GFP and check for correct segregation of progeny to maintain. iow53 inserted a GFP tag at the N-terminus of the endogenous rad-51 locus, but the tagged protein is not fully functional. non-GFP(pharynx) rad-51(iow53[GFP::rad-51]) homozygotes form GFP foci in the germline that are mostly spo-11 dependent, and GFP::rad-51 homozygotes have defects in unloading RAD-51. Created by CRISPR using pDD282, therefore may also contain 3XFLAG. Reference: Koury E, et al. Nucleic Acids Res. 2018 Jan 25;46(2):748-764.

Heterozygotes are wild-type with pharyngeal-expressed GFP, and segregate wild-type GFP+ heterozygotes, arrested nT1[qIs51] homozygotes, and viable non-GFP ubc-9(iow31[3xFLAG::ubc-9]) homozygotes. ubc-9(iow31[3xFLAG::ubc-9]) homozygotes produce 100% dead embryos, but cytologically they have normal germline (examined by DAPI and RAD-51 staining), suggesting that 3xFLAG::ubc-9 is functional in the gonad but not in the non-maternally rescued embryo. Maintain the strain by picking GFP+ worms and check for fertile non-GFP (which would indicate balancer has broken down). 3XFLAG added by CRISPR/Cas9. Synonymous point mutation where included in the repair template (positions 30, 33 and 36 of coding sequence). Reference: Reichman R, et al. Genetics. 2018 Apr;208(4):1421-1441.

Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk526 homozygotes (variable arrest, early larval). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.

Heterozygotes are wild-type with pharyngeal-expressed GFP, and segregate wild-type GFP+(pharynx) heterozygotes, arrested nT1[qIs51] homozygotes, and viable non-GFP(pharynx) ubc-9(iow97[3xFLAG::ubc-9]) homozygotes. Maintain the strain by picking wild-type GFP+ worms and checking for correct segregation of progeny. iow97 was created by CRISPR/Cas9 insertion of a 3xflag tag at the N-terminus of the endogenous ubc-9 locus; however, the tagged protein is not fully functional. SSM491 is a replacement for SSM291: analysis shows that in all parameters tested, SSM491 is identical to SSM291, which was genetically unstable and prone to breaking down. Reference: Reichman R, et al. Genetics. 2018 Apr;208(4):1421-1441.

ssrIs1248 [ges-1p(deltaB)::rpl-22::3xHA + ges-1p(deltaB)::GFP + pSM(empty vector)]. ges-1p(deltaB) is an INT1-specific promoter. Strain can be used for INT1-specific RiboTRAP experiments. Generated in N2 background. Reference: Liu C, et al. bioRxiv 2025.10.03.680215; doi: https://doi.org/10.1101/2025.10.03.680215

ssrIs1251 [pho-1p::rpl-22::3xHA + pho-1p::mCherry + pSM(empty vector)]. pho-1p is an INT2-9-specific promoter. Strain can be used for INT2-9-specific RiboTRAP experiments. Generated in N2 background. Reference: Liu C, et al. bioRxiv 2025.10.03.680215; doi: https://doi.org/10.1101/2025.10.03.680215

Null allele. ins-7(ssr1532) is a CRISPR-engineered deletion that removes the second exon of ins-7 and introduces stop codons. Reference: Liu CC, et al. Nat Commun. 2024 Aug 11;15(1):6869. doi: 10.1038/s41467-024-51077-3. PMID: 39127676.

Heterozygotes are WT and segregate WT, Dpy Uncs, and animals with muscle attachment defects and ventral cord displacement and detachment. Not well balanced. klf-3 was formerly known as mua-1.

Heterozygotes are WT and segregate WT, BliEglUnc, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development. Not well balanced.

ncIs2 [pH20::GFP + pBlueScript]. Heterozygotes are WT and segregate WT, BliEglUnc, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development. Not well balanced. Neurons visualized with ncIs2.

Heterozygotes are WT and segregate WT, BliEglUnc, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development. Not well balanced.

Heterozygotes are WT and segregate WT, BliEglUnc, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development. Not well balanced.

Various epidermal defects. In male tails, ray 1 is dislocated anteriorly.

Various epidermal defects. In male tails, ray 1 is dislocated anteriorly.

Reference: Pathare PP, et al. PLoS Genet. 2012 Apr;8(4):e1002645.

Reference: Pathare PP, et al. PLoS Genet. 2012 Apr;8(4):e1002645.