Search Strains

oaSi10 [par-5p::GFP::par-5::par-5 3' UTR + unc-119(+)] II. Maintain at 15C. Temperature-sensitive embryonic lethal. MOS single copy insertion of GFP-tagged par-5 under control of its endogenous regulatory sequences. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

oaSi10 [par-5p::GFP::par-5::par-5 3' UTR + unc-119(+)] II. MOS single copy insertion of GFP-tagged par-5 under control of its endogenous regulatory sequences. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

oaSi13 [par-5p::GFP::par-5::par-5 3' UTR(splice bias) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the PAR-5 3'UTR.2 isoform exclusively. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

oaSi11 [par-5p::par-5::par-5 3' UTR.2(prespliced) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the PAR-5 3'UTR.2 isoform exclusively. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

ddIs26 [pie-1p::mCherry::par-6 + unc-119(+)]. oaSi10 [par-5p::GFP::par-5::par-5 3' UTR + unc-119(+)] II. MOS single copy insertion of GFP-tagged par-5 under control of its endogenous regulatory sequences. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

oaSi10 [par-5p::GFP::par-5::par-5 3' UTR + unc-119(+)] II. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. MOS single copy insertion of GFP-tagged par-5 under control of its endogenous regulatory sequences. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

oaSi10 [par-5p::GFP::par-5::par-5 3' UTR + unc-119(+)] II. axIs1929 [nmy-2::GFP + mCherry::par-2]. MOS single copy insertion of GFP-tagged par-5 under control of its endogenous regulatory sequences. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

oaSi16 [par-5p::par-5::par-5 3' UTR + unc-119(+)] II. MOS single copy insertion of par-5 under control of its endogenous regulatory sequences. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

oaSi17 [par-5p::GFP::par-5::par-5 3' UTR(mutated proximal poly(A)site) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the long PAR-5 3'UTR isoforms (utr.1 and utr.2). Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

oaSi20 [par-5p::GFP::par-5::par-5 3' UTR(mutated splice sites, mutated proximal poly(A)site) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the PAR-5 3'UTR.1 isoform exclusively. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

oaSi22 [par-5p::par-5::par-5 3' UTR(splice bias) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the PAR-5 3'UTR.2 isoform exclusively. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

oaSi24 [par-5p::GFP::par-5::par-5 3' UTR(truncated) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the PAR-5 3'UTR.3 isoform exclusively. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

oaSi26 [par-5p::par-5(partially recoded)::par-5 3' UTR + unc-119(+)] II. MOS single copy insertion of partially recoded par-5 under its endogenous regulatory sequences to test gene dosage control and investigate crossregulation between the two par-5 loci. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

oaSi30 [par-5p::par-5(partially recoded)::par-5 3' UTR(splice bias) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the PAR-5 3'UTR.2 isoform exclusively to test gene dosage control and investigate crossregulation between the two par-5 loci. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

oaSi31 [par-5p::par-5(partially recoded)::par-5 3' UTR(truncated) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the PAR-5 3'UTR.3 isoform exclusively to test gene dosage control and investigate crossregulation between the two par-5 loci. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

oaSi34 [par-5p::par-5(partially recoded)::par-5 3' UTR(mutated splice sites, mutated proximal poly(A)site) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the PAR-5 3'UTR.1 isoform exclusively to test gene dosage control and investigate crossregulation between the two par-5 loci. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

oaSi37 [par-5p::par-5(partially recoded)::par-5 3' UTR(mutated proximal poly(A)site) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the long PAR-5 3'UTR isoforms (utr.1 and utr.2) to test gene dosage control and investigate crossregulation between the two par-5 loci. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

oaSi40 [par-5p::par-5(partially recoded)::par-5 3' UTR + unc-119(+)] II. MOS single copy insertion of partially recoded par-5 fused to GFP under its endogenous regulatory sequences to test gene dosage control and investigate crossregulation between the two par-5 loci. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

leIs1 [pes-1::lacZ + rol-6(su1006)] V. Rollers. B-galactosidase expression begins in a subset of cells of the AB lineage which go on to produce muscle, nerve and hypodermal cells. B-galactosidase is also present within the D lineage until the cells move anteriorly to become body wall cells. Expression is also apparent in Z1 and Z4 which go on to form part of the somatic gonad. plasmid name: pUL#24C7. Plasmid backbone: pPD22.11. Partial Sau3A fragments cloned into BamH1 site of vector.

leEx1423 [mxl-2::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

leEx1432 [hlh-10::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

leEx1439 [mxl-3::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

leEx1444 [hlh-29::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

leEx1546 [hlh-2::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

leEx1566 [lin-32::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

leEx1709 [ahr-1::GFP + unc-119(+)]. Superficially wild-type. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

leEx1713 [hlh-17::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

leIs6 [vha-8::lacZ + rol-6(su1006)]. Rollers. This strain shows B-galactosidase expression in the excretory cell and lateral nuclei of the hypodermis adjacent to the anterior and posterior branches of the excretory cell. The second component to this expression pattern appears to be localized in the hypodermis adjacent to the excretory canals. B-galactosidase was seen in the nuclei from late embryogenesis through to the adult. plasmid name: pUL#64A1. Partial Sau3A fragments cloned into BamH1 site of vector. Plasmid backbone: pPD22.11. A 2.7 Kb HindIII fragment from the insert of pUL#64A1 hybridized to YACs Y55E11, Y53F3, Y50C9, and Y73B6 which overlap on LGIV. References: Young JM, Hope IA. Dev Dyn. 1993 Feb;196(2):124-32. Hope IA, et al. Mol Gen Genet. 1998 Nov;260(2-3):300-8.

leIs8 [unc-5::lacZ + rol-6(su1006)]. Rollers. B-galactosidase expression was observed in the spermathecaeand the three rectal epithelial cells. Staining in the rectal area first observed in L1 larvae whilst expression in the spermathecae appeared as the structure formed in L4 larvae. Variable staining was also seen throughout the uterus. In the mature gonad staining appeared to be in two sets of two toroidal epithelial cells Ut-1 and Ut-2. Staining was also observed in the large H shpaed Use cell which attaches the uterus to the seam cells and the four epithelial cells Ut-1 and Ut-2. The Uv cells did not appear to stain. Individual worms often just showed one component of this expression. In males the expression was observed to be displayed in all or part of the procodeum. plasmid name: pUL#38E12. plasmid backbone: pPD22.11. Partial Sau3A fragments cloned into BamH1 site of vector.

xbIs1502 [act-1::GFP + rol-6(su1006)]. GFP-labeled actin in the spermatheca. Reference: Wirshing ACE &, Cram EJ. Mol Biol Cell. 2017 Jul 7;28(14):1937-1949. doi: 10.1091/mbc.E17-01-0029. PMID: 28331075

csEx436 [lpr-3 (fosmid WRM619dE09) + myo-2p::mCherry]. Pick mCherry+ animals to maintain. cs231 is a Crispr/Cas9-induced null allele of lpr-3: a 13 nucleotide deletion in exon 1 results in frameshift. Homozygous mutants are embryonic lethal, but are rescued by csEx436 containing lpr-3(+) fosmid WRM619dE09. NOTE: lpr-3(cs231) should be considered the canonical allele as ok2351 also perturbs expression of adjacent gene lpr-6. Reference: Forman-Rubinsky R, Cohen JD and Sundaram MV. Genetics. 2017 Oct;207(2):625-642.

csEx919 [WRM069E05 + sur-5p::GFP]. Pick GFP+ to maintain. bli-4(cs281) is a null allele and causes embryonic lethality. csEx919 contains a bli-4(+) fosmid WRM069E05 and rescues bli-4 lethality. cs281 is a 1nt deletion causing a frameshift before the peptidase domain. GTGGGGAACCAATACATACC -> GT-GGGAACCAATACATACC. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.

narSi2 [mex-5p::GFP::mpk-1B + unc-119(+)] II. narEx29 [sur-5p::GFP::mpk-1A + myo-3p::RFP]. mpk-1(-) strain with germline MPK-1B rescued by single-copy insertion and somatic MPK-1A rescued by an extrachromosomal array. Pick RFP+ to maintain; narEx29 rescues mpk-1 so array should be stable. Transgene uses codon-optimized version of GFP. Reference: Robinson-Thiewes et al. Cell Reports, In Press.

Homozygous viable, Rol. nar12 (non-excised strain) is null for par-4A & C, but not for par-4B, and is viable. Low rate of spontaneous excision even when maintained at 15C. Pick Rollers to maintain. Reference: Roy et al. microPublication Biology. https://www.micropublication.org/roy_2018_mngpar-4.html

narSi2 [mex-5p::GFP::mpk-1B + unc-119(+)] II. mpk-1(-) strain with germline-specific expression of GFP::MPK-1B. GFP::MPK-1B rescues fertility but the animals are still Vulvaless. Transgene uses codon-optimized version of GFP. Reference: Robinson-Thiewes et al. Cell Reports, In Press.

mScarlet-I-GLO and Myc tags inserted into endogenous par-3 locus. mScarlet-I-GLO is a germline-optimized variant coded to be less prone to silencing in the germline. Reference: Chang Y & Dickinson DJ. Cell Rep. 2022 Apr 12;39(2):110652. doi: 10.1016/j.celrep.2022.110652. PMID: 35417695.

pqIs2 [alp-1::GFP]. Maintain by picking GFP+. GFP is inserted in-frame in exon 14: all four ALP-1 isoforms will be expressed but only ALP-1a will be tagged with GFP. References: McKeown et al. Dev Dyn. 2006 Feb;235(2):530-8 & Han & Beckerle Cell 2009 May; 20(9):2361-70.

pqIs3 [alp-1::GFP]. Maintain by picking GFP+. GFP is inserted in-frame in exon 18: all four ALP-1 isoforms will be expressed but only ALP-1b, ALP-1c, and ALP-1d will be tagged with GFP. Isoforms ALP-1b, ALP-1c, and ALP-1d are collectively known as the Enigma isoforms or ALP-1bcd/Enigma::GFPs. References: McKeown et al. Dev Dyn. 2006 Feb;235(2):530-8 & Han & Beckerle Cell 2009 May; 20(9):2361-70.

pqIs4 [alp-1::GFP]. Maintain by picking GFP+. GFP is inserted in-frame in exon 18: all four ALP-1 isoforms will be expressed but only ALP-1b, ALP-1c, and ALP-1d will be tagged with GFP. Isoforms ALP-1b, ALP-1c, and ALP-1d are collectively known as the Enigma isoforms or ALP-1bcd/Enigma::GFPs. References: McKeown et al. Dev Dyn. 2006 Feb;235(2):530-8 & Han & Beckerle Cell 2009 May; 20(9):2361-70.

Reference: Tang L, et al. Mol Biol Cell. 2010 Mar 15;21(6):885-96.

Reference: Tang L, et al. Mol Biol Cell. 2010 Mar 15;21(6):885-96.

svIs69 [daf-28p::daf-28::GFP + unc-4(+)]. Derived from injection of pVB298gk (daf-28p::daf-28::GFP) with unc-4(+) into unc-4(e120). unc-4(e120) was likely removed during out-crossing, but might still be in background.

H23L24.3b. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F33H2.5. mIs13 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] I. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Heterozygotes are WT with dim GFP signal in pharynx, and segregate WT with dim GFP, WT with brighter GFP (WT homozygotes), and GFP- sterile Uncs with a vulval blip. Pick dim GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59G1.3. Small. External left primer: AAAATTCGGGGAATACGACC. External right primer: TTTCCATGGACCTGAACACA. Internal left primer: GATCAGTCGATTCGGGTTGT. Internal right primer: TATTCTGACGGGAAAGGTGG. Internal WT amplicon: 3041 bp. Deletion size: 1590 bp. Deletion left flank: CATTTGGCAACATTAACCGAGTTTTTGAAT. Deletion right flank: CGATCACATTGAAGAGCTTATCGCACGAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F15H10.3, F15H10.4. Superficially wild type, with small broods of viable progeny and lots of unfertilized oocytes. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK856.9, ZK856.13. mIs10 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] V. WT GFP phenotype, with expression in 4-cell embryos, pharyngeal muscle and gut. Heterozygotes are WT with dim GFP signal in pharynx, and segregate WT with dim GFP, WT with brighter GFP (mIs10 homozygotes), and non-GFP sterile Uncs with a vulval blip (gk144 homozygotes). mIs10 suppresses recombination from unc-60 to about dpy-11 on LG V, and does not balance gk144 perfectly, but this strain is not difficult to keep. Pick dim GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C14B1.4, C14B1.5. Slow-growing, small broods. Deletion removes 3' end of C14B1.4, 5' end of C14B1.5. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C36B1.8. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2141 homozygotes (often sterile or nearly sterile, but a population can be maintained and will starve a plate). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAAGGACGGCTGTTCCTAAA. External right primer: CATATTGAGCTGGAGTCGCA. Internal left primer: CGAGTACAGAACCGAGGAGG. Internal right primer: ACAATACGCTCTCCGTTTGG. Internal WT amplicon: 3357 bp. Deletion size: 1835 bp. Deletion left flank: TTCTAGCATCTAAATTTTAACAATTAGATT. Deletion right flank: AAATGTATTTTACAACACAATTTCCCTCTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C01G8.9. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk816 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. (Note: in this strain hT2[qIs48] occasionally recombines such that the GFP and its associated lethality are lost and the non-GFP hT2 left behind still carries the bli-4 mutation of the original hT2. Such a recombination event results in a viable non-GFP animal that is no longer gk816/hT2[qIs48] but is gk816/hT2.) External left primer: GCCATCACTTTCATCGGATT. External right primer: AATAGACGGCACGTGGAAAC. Internal left primer: ATTCGTTGTTGATAAGCCGC. Internal right primer: ATGACCGATGATGATGACGA. Internal WT amplicon: 1843 bp. Deletion size: 1268 bp. Deletion left flank: AGACATAGACGTCATGCGAAAAATAATATA. Deletion right flank: TCTATATATTCTCCGCGTGGTGGGCTATTT. Insertion Sequence: TATAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807