Search Strains

More Fields
Strain Species Genotype Add
VT3107 C. elegans maIs388 II; mir-83(n4638) IV. Show Description
maIs388 [lim-7p::mir-83 + Cbr-unc-119(+)] II. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3108 C. elegans maIs389 II; mir-83(n4638) IV. Show Description
maIs389 [dpy-7p::mir-83 + Cbr-unc-119(+)] II. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3109 C. elegans maIs390 II; mir-83(n4638) IV. Show Description
maIs390 [myo-3p::mir-83 + Cbr-unc-119(+)] II. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3110 C. elegans maIs391 II; mir-83(n4638) IV. Show Description
maIs391 [mir-83p::mir-83 + Cbr-unc-119(+)] II. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3111 C. elegans maIs392 II; mir-83(n4638) IV. Show Description
maIs392 [lag-2p::mir-83 + Cbr-unc-119(+)] II. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3118 C. elegans unc-119(ed3) III; mir-83(n4638) IV; mir-34(gk437) X; maEx246. Show Description
maEx246 (cdc-42p::GFP::H2B::cdc-42(mutated) 3`UTR + cdc-42p::mCherry::H2B::cdc-42 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3123 C. elegans maIs396 I; mir-34(gk437) X. Show Description
maIs396 [dpy-7p::mir-34 + Cbr-unc-119(+)] I. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3124 C. elegans maIs397 I; mir-34(gk437) X. Show Description
maIs397 [lag-2p::mir-34 + Cbr-unc-119(+)] I. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3136 C. elegans unc-119(ed3) III; maEx246. Show Description
maEx246 (cdc-42p::GFP::H2B::cdc-42(mutated) 3`UTR + cdc-42p::mCherry::H2B::cdc-42 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3145 C. elegans unc-119(ed3) III; mir-83(n4638) IV; mir-34(gk437) X; maEx247. Show Description
maEx247 (pat-3p::GFP::H2B::pat-3(mutated) 3`UTR + pat-3p::mCherry::H2B::pat-3 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3178 C. elegans unc-119(ed3) III; maEx247. Show Description
maEx247 (pat-3p::GFP::H2B::pat-3(mutated) 3`UTR + pat-3p::mCherry::H2B::pat-3 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3289 C. elegans mir-83(n4638) IV; mir-34(gk437) X. Show Description
DTC migration defects. Generated from VT3106 and VT3110. VC3289 has the genotype as VT2595 but made from different parental strains. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3294 C. elegans maIs387 I; maIs391 II; mir-83(n4638) IV; mir-34(gk437) X. Show Description
maIs387 [mir-34p::mir-34 + Cbr-unc-119(+)] I. maIs391 [mir-83p::mir-83 + Cbr-unc-119(+)] II. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3500 C. elegans wIs51 V; hbl-1(ma354) X. Show Description
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Gain-of-function allele causing retarded heterochronic defects including extra seam cells and absence of alae in young adult animals. ms354 is a 1120 bp deletion removing most of the hbl-1 3'UTR including all let-7-complementary sites. Sequences flanking the deletion: TTCTAATCATGGCCAGTTTCTTGCA and GTGCGTTCTTCTGTCATCATGTACA. Reference: Ilbay O & Ambros A. Development. 2019 Oct 9. pii: dev.183111. doi: 10.1242/dev.183111.
VT3650 C. elegans lin-46(ma398[lin-46::mCherry]) V. Show Description
mCherry reporter inserted into C-terminus of endogenous lin-46 locus. Superficially wild-type. Fluorescent signal is very dim and bleaches very quickly. Reference: Ilbay O, et al. C. elegans LIN-28 controls temporal cell-fate progression by regulating LIN-46 expression via the 5’UTR of lin-46 mRNA. bioRxiv 697490; doi: https://doi.org/10.1101/697490.
VT3727 C. elegans lin-28(ma426[lin-28::GFP]) I. Show Description
GFP reporter inserted into C-terminus of endogenous lin-28 locus. Superficially wild-type. Reference: Ilbay O, et al. C. elegans LIN-28 controls temporal cell-fate progression by regulating LIN-46 expression via the 5’UTR of lin-46 mRNA. bioRxiv 697490; doi: https://doi.org/10.1101/697490.
VT509 C. elegans lin-4(e912) II; maEx114. Show Description
maEx114 [lin-4(+) + rol-6(su1006)]. Pick Rollers to maintain. lin-4 loss-of-function is rescued by the maEx114 extrachromosomal array expressing lin-4 microRNA. Reference: Lee RC, et al. Cell. 75, 843-854.
VT733 C. remanei ssp. vulgaris Show Description
Male-female strain. Reference WBG 11(4):89. See also WBPaper00001874. May crawl off the plates. Isolated by Bill Fixsen at a rest area on the turnpike in Conn. Previously called WS9-6 and C. vulgaris NH and C. vulgariensis by the CGC. Walter Sudhaus has tentatively described this strain as C. remanei ssp. vulgaris; this description is not official and is contigent upon its being published. See WBPaper00002633.
VT757 C. elegans lin-28(n719) I; lin-12(n137n460) III. Show Description
Only gives a decent brood size at 20C. At 15C: Muv/Blip. At 20C: some Muv/Blip, some Blip but not Muv. At 25C: Not Muv, but do have Blip (due to lin-12). Egl- at all temps.
VT825 C. elegans dpy-20(e1282) IV; maIs113. Show Description
maIs113 [cki-1::GFP + dpy-20(+)]. Non-Dpy. cki-1::GFP is expressed in all arresting cells that have exited cell cycle.
VX80 C. latens Show Description
Caenorhabditis sp. 23 Male-female strain. Caenorhabditis elegans wild isolate. H2. Isolated from pill bug in Juifeng Village, Wuhan City, Hubei Province. Lat: 30°30'51"; Lon: 114°29'42".
VX81 C. latens Show Description
Caenorhabditis sp. 23 Male-female strain. Caenorhabditis elegans wild isolate. H3. Isolated from pill bug in Juifeng Village, Wuhan City, Hubei Province. Lat: 30°30'51"; Lon: 114°29'42".
VX82 C. latens Show Description
Caenorhabditis sp. 23 Male-female strain. Caenorhabditis elegans wild isolate. H4. Isolated from pill bug in a Chinese cabbage field, Juifeng Village, Wuhan City, Hubei Province. Lat: 30°30'51"; Lon: 114°29'42".
VX83 C. latens Show Description
Caenorhabditis sp. 23 Male-female strain. Caenorhabditis elegans wild isolate. H5. Isolated from pill bug under roadside haystack, Juifeng Village, Wuhan City, Hubei Province. Lat: 30°30'51"; Lon: 114°29'42".
VX84 C. latens Show Description
Caenorhabditis sp. 23 Male-female strain. Caenorhabditis elegans wild isolate. H6. Isolated from pill bug under rotten grass, Juifeng Village, Wuhan City, Hubei Province. Lat: 30°30'51"; Lon: 114°29'42".
VX86 C. latens Show Description
Caenorhabditis sp. 23 Male-female strain. Caenorhabditis elegans wild isolate. H8. Isolated from pill bug in a vegetable field, Juifeng Village, Wuhan City, Hubei Province. Lat: 30°30'51"; Lon: 114°29'42".
VZ454 C. elegans gsr-1(tm3574)/qC1 dpy-19(e1259) glp-1(q339) nIs281 III. Show Description
nIs281 [myo-2::RFP] integrated near qC1. Recombination between nIs281 and qC1 has been reported. Fails to complemement all markers on qC1. Heterozygotes are WT and segregate WT, Dpy Sterile, and tm3574 homozygotes. gsr-1(tm3574) is embryonic lethal. gsr-1(m+,z-) animals are viable and reach adulthood with no visible phenotype and lay eggs that invariably arrest at the pregastrula stage; they are slightly short-lived, have increased mitochondrial fragmentation, decreased mitochondrial DNA content and have induced mitochondrial UPR measured by hsp-6::GFP levels. gsr-1(m-,z-) have aberrant perinuclear distribution of interphasic chromatin. NOTE: The RFP-labeled balancer is reportedly not entirely stable in this strain and will occasionally segregate recombinants of two types: sterile RFP+ animals (most likely homozygous qC1 [nIs281] worms that are able to grow to adulthood but do not develop germline), and non-RFP animals that lay viable progeny. Maintain by picking fertile RFP+ animals and confirming that non-RFP progeny lay 100% arrested embryos. Reference: Mora-Lorca JA, et al. Free Radic Biol Med. 2016 Jul;96:446-61.
WBM1177 C. elegans wbmIs81. Show Description
wbmIs81 [eft-3p::3XFLAG::GFP::SKL::unc-54 3'UTR *wbmIs65] (V:8645000). Ubiquitous expression of peroxisome-targeted GFP. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. Derived from parental strain WBM1140 by CRISPR-mediated insertion of peroxisome-targeted GFP downstream of tissue-specific eft-3 promoter inserted as a single copy into the C. elegans genome (wbmIs65). Outcrossed six times to WBM lab stock of N2. Reference: Papsdorf K, et al. Nat Cell Biol. 2023 May;25(5):672-684. doi: 10.1038/s41556-023-01136-6. 2023. PMID 37127715.
WBM132 C. elegans wbmEx49. Show Description
wbmEx49 [rab-3p::crtc-1(S76A, S179A)::tdTomato::unc-54 UTR]. tdTOMATO-tagged, non-phosphorylatable CRTC-1 expression in neurons. Pick fluorescent animals to maintain. Reference: Burkewitz K, et al. Cell. 2015 Feb 26; 160(5): 842-55.
WBM1339 C. elegans wbmIs118 I. Show Description
wbmIs118 [myo-3p::3XFLAG::rpl-22::SL2::wrmScarlet::unc-54 3'UTR, *wbmIs114] I. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in muscle. wrmScarlet expression in muscle. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs114. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433
WBM1340 C. elegans wbmIs99 IV. Show Description
wbmIs99 [rab-3p::3xFLAG::rpl-22::SL2::wrmScarlet::rab-3 3'UTR, *wbmIs89] IV. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in the nervous system. wrmScarlet expression in nervous system. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs89. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433
WBM1364 C. elegans wbmIs119 V. Show Description
wbmIs119 [eft-3p::3XFLAG::rpl-22::SL2::wrmScarlet::unc-54 3'UTR, *wbmIs88] V. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in soma. wrmScarlet expression in soma. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs88. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433
WBM1470 C. elegans wbmIs131 V. Show Description
wbmIs131 [nep-17p::3XFLAG::rpl-22::SL2::wrmScarlet::unc-54 3'UTR, *wbmIs119] V. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in the intestine. wrmScarlet expression in the intestine. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs119. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433
WBM1471 C. elegans wbmIs133 V. Show Description
wbmIs133 [rab-3p::3XFLAG::rpl-22::SL2::scarlet::rab-3 3'UTR, *wbmIs127] (V:8645000). N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in the nervous system. wrmScarlet expression in nervous system. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs127. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433
WBM170 C. elegans wbmEx57. Show Description
wbmEx57 [acs-2p::GFP + rol-6(su1006)]. Pick Rollers to maintain. Reference: Burkewitz K, et al. Cell. 2015 Feb 26; 160(5): 842-55.
WBM179 C. elegans wbmEx64. Show Description
wbmEx64 [rab-3p::nhr-49(cDNA)::unc-54 3'UTR + myo-3p::mCherry::unc54 3'UTR]. mCherry expression in muscle. Pick fluorescent animals to maintain. Reference: Burkewitz K, et al. Cell. 2015 Feb 26; 160(5): 842-55.
WBM184 C. elegans wbmEx69. Show Description
wbmEx69 [ges-1p::crtc-1(cDNA S76A, S179A)::tdTOMATO::unc-54 3'UTR]. tdTOMATO-tagged, non-phosphorylatable CRTC-1 expression in intestinal cells. Fluorescence may be difficult to see at lower magnifications. Pick fluorescent animals to maintain. Reference: Burkewitz K, et al. Cell. 2015 Feb 26; 160(5): 842-55.
WBM34 C. elegans uthIs205. Show Description
uthIs205 [crtc-1p::crtc-1::tdTOMATO::unc-54 3'UTR + rol-6(su1006)]. Rollers. tdTOMATO-tagged CRTC-1 expression from native promoter. Reference: Burkewitz K, et al. Cell. 2015 Feb 26; 160(5): 842-55.
WBM409 C. elegans nhr-49(nr2041) I; wbmEx149. Show Description
wbmEx149 [ges-1p::3xHA::nhr-49(cDNA)::unc-54 3'UTR + myo-3p::mCherry::unc-54 3'UTR]. mCherry expression in muscle cells. Pick fluorescent animals to maintain. Intestine-specific rescue of nhr-49 null animals. Reference: Burkewitz K, et al. Cell. 2015 Feb 26; 160(5): 842-55.
WBM55 C. elegans uthIs226. Show Description
uthIs226 [crtc-1p::crtc-1(S76A, S179A)::tdTOMATO::unc-54 3'UTR + rol-6(su1006)]. Rollers. tdTOMATO-tagged, non-phosphorylatable CRTC-1 expression from native promoter. Constitutively nuclear expression in neurons and intestine. Reference: Burkewitz K, et al. Cell. 2015 Feb 26; 160(5): 842-55.
WBM60 C. elegans uthIs248. Show Description
uthIs248 [aak-2p::aak-2(genomic aa1-321)::GFP::unc-54 3'UTR + myo-2p::tdTOMATO]. Ubiquitous GFP expression and pharynx-specific tdTomato expression. Small with slight developmental delay and reduced reproductive capacity. Some phenotypes silence quickly. Reference: Burkewitz K, et al. Cell. 2015 Feb 26; 160(5): 842-55.
WE5172 C. elegans dpy-5(e907) I; ajIs1 X. Show Description
ajIs1 [rCesC05A9.1::GFP + dpy-5(+)] X. GFP expression driven by 300bp sequence upstream of pgp-5 gene. Weak intestinal fluorescence is visible under normal conditions. Derived by insertion of sEx864 in parental strain BC10030. Pathogens, heavy metals, and toxins (e.g. Pseudomonas aeruginosa, cadmium, G418) further induce GFP expression. dpy-5(e907) was likely removed by outcrossing, but might still be in the background. Reference: McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525); WBPaper00031023; WBPaper00048491.
WH108 C. elegans abc-1(oj2) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Uncs, dead eggs and abc-1 homozygotes. At 25C abc-1 homozygotes are sterile Unc animals. At 16C abc-1 homozygotes are fertile animals that produce all dead eggs.
WH163 C. elegans nDf29/unc-13(e1091) spd-2(oj29) I. Show Description
Heterozygotes are WT and segregate WT, dead eggs and Uncs. At 25C the Unc Spds are Sterile; at 16C the Unc Spds are fertile but produce mostly dead eggs. Unc Spd animals will exhibit a fully penetrant maternal-effect embryonic lethal phenotype if shifted to 25C at the L4 stage. unc-13 spd-2 homozygotes may be propagated at 16C but may become sick causing immense frustration! See also WBPaper00004200.
WH170 C. elegans eff-1(oj55) II. Show Description
Loss of cell fusion in hypodermis (epithelial fusion failures). Viable and fertile as homozygotes. Tail-spike defect in all young larvae, less visible in older larvae and adults. oj55 appears to cause incomplete loss of function, as many cells fuse in postembryonic development. Homozygous males have tail and mating defects. ES-3. Cloned: ORF C26D10.5 encodes a type-I membrane glycoprotein with a single TM domain.
WH171 C. elegans eff-1(oj55) II; jcIs1 IV. Show Description
jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. Loss of cell fusion in hypodermis (epithelial fusion failures). Viable and fertile as homozygotes. Tail-spike defect in all young larvae, less visible in older larvae and adults. oj55 appears to cause incomplete loss of function, as many cells fuse in postembryonic development. Homozygous males have tail and mating defects. ES=3. Cloned: ORF C26D10.5 encodes a type-I membrane glycoprotein with a single TM domain. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Mohler WA, et al. Curr Biol. 1998 Sep 24;8(19):1087-90.
WH204 C. elegans unc-119(ed3) III; ojIs1. Show Description
ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Maintain under normal conditions. Reference: Strome et al. (2001) Mol Biol Cell (6):1751-64.
WH223 C. elegans ojIs9. Show Description
ojIs9 [zyg-12(all)::GFP + unc-119(+)].
WH346 C. elegans unc-119(ed3) III; ojIs34. Show Description
ojIs34 [GFP::car-1 + unc-119(+)]. N'-tagged GFP::CAR-1 (Y18D10A.17) fusion. Labels P-granules and small cytoplasmic puncta in all cells. Bombardment with pNL1.6::GFP::unc-119 (pfj-1::pie-1 promoter driving GFP::Y18D10A.17 (N-terminal) with unc-119 rescuing fragment).
WH497 C. elegans unc-119(ed3) III; ojIs69. Show Description
ojIs69 [pie-1::mGFP::chin-1 + unc-119(+)]. N-terminal fusion of mGFP to sole predicted BE0003N10.2 ORF. Reference: Kumfer et al. (2010) Mol Biol Cell (2):266-77.