Search Strains

More Fields
Strain Species Genotype Add
EJ374 C. elegans gon-2(dx22) fer-1(hc1) unc-29(e1072) I. Show Description
Unc. Temperature senstive for both gon-2 and fer-1. Maintain at 15C. Will also grow at 20C. Received new stock 10/12/00 from EJ.
EJ420 C. elegans gon-2(dx23) fer-1(hc1) I. Show Description
Temperature sensitive for both gon-2 and fer-1. Maintain at 15C. Will also grow at 20C.
EM116 C. elegans mab-25(bx27) I; him-5(e1490) V. Show Description
Temperature sensitive. Missing Ray. Swollen tail and reduced fan. Temperature sensitive lethal at all stages. Wrinkled spicule.
EM141 C. elegans unc-17(e113) col-34(bx25) IV; him-5(e1490) V. Show Description
Unc. Abnormal rays. bx25 previously called ram-4.
EM66 C. elegans him-5(e1490) V; vab-3(bx23) X. Show Description
Transformation of ray 6 to a thin ray which is anteriorly displaced and fuses with ray 4 (99%). Body is slightly shorter. See also WBPaper00002235.
EM67 C. elegans mab-20(bx24) I; him-5(e1490) V. Show Description
Extensive ray fusion. Posterior portion of body swollen at larval stages.
EM68 C. elegans col-34(bx25) IV; him-5(e1490) V. Show Description
Lumpy rays. Temperature sensitive. bx25 previously called ram-4.
ET182 C. elegans ekEx25. Show Description
ekEx25 [wrt-2p::CDC-6::GFP + rol-6(su1006)]. Pick Rollers to maintain the extrachromosomal array.
EU2470 C. elegans unc-119(ed3) III; orEx25. Show Description
orEx25 [GFP::aspm-1 + unc-119(+)]. Maintain at 25C. Pick non-Unc GFP+ to maintain. GFP might not be visible at low magnification. Reference: Connolly AA, et al. Mol Biol Cell. 2014 Apr;25(8):1298-311.
FK183 C. elegans daf-11(ks67) V; ksEx29. Show Description
ksEx29 [daf-7::GFP + lin-44::GFP]. Maintain by picking GFP. daf-7::GFP is dark or invisible. lin-44::GFP is bright in the tail. Grows better at 15C.
FX2066 C. elegans his-72(tm2066) III. Show Description
Homozygous viable and fertile. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
FX2355 C. elegans ift-81(tm2355) X. Show Description
Superficially WT. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
FX2394 C. elegans ift-74(tm2394) II. Show Description
Superficially WT. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
FX291 C. elegans +/eT1 III; spn-4(tm291)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. 1/3 of WT animals (spn-4 homozygotes) are Mels: segregate only dead embryos with have no morphogenesis. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
FX2956 C. elegans mps-4(tm2596) III. Show Description
Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
GLW27 C. elegans muIs252 II; unc-119(ed3) his-72(utx21[his-72::wrmScarlet11::3xMyc]) III. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of HIS-72 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous his-72 locus. Genetic background: strain CF4582. Insertion verified by PCR and fluorescence. Left flank: 5' CTCGCCAGACGCATTCGCGGAGAACGTGCT 3' (one silent mutation); Right flank: 5' TAAgctccatcaccaattctcgaagcactt 3'; sgRNA: GAGCTTAAGCACGTTCTCCG; Cas9/sgRNA plasmid: pGLOW87; wrmScarlet11^SEC^3xMyc plasmid: pGLOW88; SEC insertion allele strain: GLW26
GLW29 C. elegans muIs252 II; unc-119(ed3) III; egl-1(utx23[egl-1::wrmScarlet11::3xMyc]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of EGL-1 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous egl-1 locus. Genetic background: strain CF4582. Insertion verified by PCR, Sanger sequencing, and fluorescence. Left flank: 5' CAGAAGTCTCTTCCATCGTCTTCTGGACTTTTTCGCTTTT 3' (one silent mutation); Right flank: 5' TAAgtgatcaaaatctccaacttttctcca 3'; sgRNA: AGTCCAGAAGACGATGGAAG; Cas9/sgRNA plasmid: pGLOW65; wrmScarlet11^SEC^3xMyc plasmid: pGLOW66; SEC insertion allele strain: GLW28.
GLW33 C. elegans T28D6.6(utx25[T28D6.6::mNG::3xFlag]) III. Show Description
Superficially wild type. C-terminal tag of T28D6.6 via CRISPR/Cas9 knock-in of mNeonGreen at T28D6.6 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gtcgcaaataatggttttttttccagAGTC 3'; Right flank: 5' TAAgctgaaattcccgtgcttctcgtcttc 3'; sgRNA: gggaatttcagcTTAGACTc; Cas9/sgRNA plasmid: pGLOW2; mNG^SEC^3xFlag plasmid: pGLOW42; SEC insertion allele strain: GLW32. Reference: Huang et al. 2021. Improved CRISPR/Cas9 knock-in efficiency via the self-excising cassette (SEC) selection method in C. elegans. 2021 Sep 16;2021:10.17912/micropub.biology.000460. doi: 10.17912/micropub.biology.000460. eCollection 2021.
GLW35 C. elegans gldi-2(utx27[mNG::3xFlag::T13C2.6]) II. Show Description
T13C2.6. N-terminal tag of T13C2.6 via CRISPR/Cas9 knock-in of mNeonGreen at gldi-2 locus. Insertion verified by PCR and fluorescence. Left flank: 5' aaatattaattgataatcagaggagtaaaa 3'; Right flank: 5' ATGAGGACATGTCTCACCCTCACGGGTTTC 3'; sgRNA: taatcagaggagtaaaaATG; Cas9/sgRNA plasmid: pGLOW45; mNG^SEC^3xFlag plasmid: pGLOW54; SEC insertion allele strain: GLW34.
GS9402 C. elegans arTi362 Show Description
arTi362 [rps-27p::TIR1(lox2272-flexon-lox2272)::unc-54 3'UTR + HygroR] V (-19.98). The first intron of TIR1 was replaced with a Flexon containing two lox2272 sites. TIR1 is expressed at a high level in lineages where Cre is expressed. Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology. 10.17912/micropub.biology.001315.
GS9407 C. elegans arTi361 [rps-27p::GFP(lox2272-flexon-lox2272)::H2B::unc-54 3'UTR + NeoR] I. Show Description
arTi361 [rps-27p::GFP(lox2272-flexon-lox2272)::H2B::unc-54 3'UTR + NeoR] I (-12.74). First intron of GFP is replaced with a Flexon containing two lox2272 sites. GFP::H2B is expressed at a high level in lineages where Cre is expressed with a second transgene. Transgene maps to -12.74 (I). Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology.
GS9801 C. elegans rde-1(ar660) V. Show Description
rde-1(ar660)[rde-1(lox2272-flexon-lox2272)]. 9th intron of rde-1 replaced with a flexon - an artificial exon flanked by artificial introns that each contain a lox2272 site (a flexon). Severely reduces rde-1 function, function can be restored upon excision of the flexon by Cre recombinase. Reference: Shaffer JM & Greenwald I. Proc Natl Acad Sci U S A. 2022 Jan 18;119(3):e2117451119. doi: 10.1073/pnas.2117451119. PMID: 35027456.
GS9820 C. elegans arTi443 Show Description
arTi443 [rps-27p::TIR1(F79G)(lox2272-flexon-lox2272)::unc-54 3'UTR + HygroR] V (+21.99). The first intron of TIR1(F79G) was replaced with a Flexon containing two lox2272 sites. TIR1(F79G) is expressed at a high level in lineages where Cre is expressed with a second transgene. Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology. 10.17912/micropub.biology.001315.
GT330 C. elegans aSi8 II; unc-119(ed3) III. Show Description
aSi8 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7s::egl-13-NLS::SL2::NLS::mScarlet-I:: egl-13-NLS] II. mec-7 promoter driving nuclear-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.
GT332 C. elegans aSi10 II; unc-119(ed3) III. Show Description
aSi10 [lox2272 Cbr-unc-119(+) lox2272 + loxP::unc-54 3’UTR::Split 3’ HygR::tjp2a_guide::Split 3’ mScarlet-I::egl-13nls::tbb-2 3’UTR]?II. Strain contains a specialized safe harbor transgene landing pad for integration of promoters to drive mScarlet. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.
GT337 C. elegans aSi13 II; unc-119(ed3) III. Show Description
aSi13 [lox2272 + loxN 3' (delta)Cbr-unc-119(+) + 3' (delta)mNeonGreen::PEST] aSi14[lox2272 + loxP 3’ (delta)HygR + 3’ (delta)mScarlet-I::PEST]?II. Unc. Strain contains a set of dual specialized safe harbor transgene landing pads for integration of promoters: one driving mScarlet and rescuing hygromycin resistance upon integration, the other driving mNeonGreen and rescuing the unc phenotype upon integration. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.
GT347 C. elegans aSi23 II; unc-119(ed3) III. Show Description
aSi23 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7f::egl-13-NLS::SL2::NLS::mScarlet-I:: egl-13-NLS] II. mec-7 promoter driving nuclear-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.
GT350 C. elegans aSi26 II; unc-119(ed3) III. Show Description
aSi26 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7s::ras-2-CAAX::SL2::mScarlet-I::ras-2-CAAX] II. mec-7 promoter driving membrane-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.
GT372 C. elegans aSi31 II; unc-119(ed3) III Show Description
aSi31 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7f::ras-2-CAAX::SL2::mScarlet-I::ras-2-CAAX] II. mec-7 promoter driving membrane-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.
GT375 C. elegans aSi27 II; unc-119(ed3) III. Show Description
aSi27 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p::GCaMP7s::SL2::mScarlet-I] II. mec-7 promoter driving expression of GCaMP7s in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.
GT377 C. elegans aSi36 II; unc-119(ed3) III. Show Description
aSi36 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p::GCaMP7f::SL2::mScarlet-I] II. mec-7 promoter driving expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.
HA300 C. elegans lin-15B&lin-15A(n765) X; rtEx223. Show Description
rtEx223 [nlp-6p::GFP + lin-15(+)]. Maintain at 20C or warmer. Pick GFP+ non-Muv to maintain. Reference: Nathoo AN, et al. Proc Natl Acad Sci U S A. 2001 Nov 20;98(24):14000-5.
HA307 C. elegans lin-15B&lin-15A(n765) X; rtEx224. Show Description
rtEx224 [F18E9.2::GFP + lin-15(+)]. Maintain by picking non-Muv. Maintain at 20C.
HA328 C. elegans lin-15B&lin-15A(n765) X; rtEx233. Show Description
rtEx233 [nlp-11p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv to maintain array.
HA329 C. elegans lin-15B&lin-15A(n765) X; rtEx234. Show Description
rtEx234 [nlp-13p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv or GFP+ to maintain array.
HA341 C. elegans lin-15B&lin-15A(n765) X; rtEx235. Show Description
rtEx235 [nlp-3p::GFP + lin-15(+)]. Maintain at 20C or warmer. Pick GFP+ non-Muv to maintain. Reference: Nathoo AN, et al. Proc Natl Acad Sci U S A. 2001 Nov 20;98(24):14000-5.
HA353 C. elegans lin-15B&lin-15A(n765) X; rtEx247. Show Description
rtEx247 [nlp-14p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv to maintain array.
HA357 C. elegans lin-15B&lin-15A(n765) X; rtEx251. Show Description
rtEx251 [nlp-15p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv to maintain array.
HA367 C. elegans lin-15B&lin-15A(n765) X; rtEx256. Show Description
rtEx256 [nlp-18p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv to maintain array.
HA371 C. elegans lin-15B&lin-15A(n765) X; rtEx260. Show Description
rtEx260 [nlp-19p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv to maintain array.
HS1215 C. elegans unc-76(e911) V; osEx211. Show Description
osEx211[apr-1::GFP + unc-76(+)]. This strain expresses functional APR-1::GFP driven by the apr-1 promoter. In the seam cells, just prior to the onset of mitosis, APR-1::GFP localizes to the anterior cortex.
HS1257 C. elegans unc-76(e911) V; osEx219. Show Description
osEx219 [pbrm-1::GFP + unc-76(+)]. Pick wild-type to maintain. GFP expression in most somatic nuclei. Reference: Shibata Y, et al. Dev Biol. 2012 Jan 15;361(2):349-57.
HS1294 C. elegans unc-76(e911) V; osEx225. Show Description
osEx225 [scm::dsh-2::venus + unc-76(+)]. Pick non-Unc to maintain. Reference: Mizumoto K, Sawa H. Dev Cell. 2007 Feb;12(2):287-99.
HS1325 C. elegans unc-76(e911) V; osEx229. Show Description
osEx229 [pry-1::GFP + unc-76(+)]. This strain expresses functional pry-1::GFP driven by the pry-1 promoter. In the seam cells, just prior to the onset of mitosis, pry-1::GFP localizes to the anterior cortex.
HS1359 C. elegans unc-76(e911) V; osEx233. Show Description
osEx233 [scm::mig-5::venus + unc-76(+)]. Pick non-Unc to maintain. Reference: Mizumoto K, Sawa H. Dev Cell. 2007 Feb;12(2):287-99.
HS1380 C. elegans unc-76(e911) V; osEx240. Show Description
osEx240 [bet-1p::bet-1::GFP + unc-76(+)]. Pick Wild-type (non-Unc) to maintain. GFP expression in most somatic cells. Reference: Shibata Y, et al. Development. 2010 Apr;137(7):1045-53.
IG358 C. elegans oxEx229. Show Description
oxEx229 [Mos1 Substrate + myo-2::GFP]. Pick GFP+ to maintain. Should be grown at 25C. Reference: Vallin E, et al. PLoS One. 2012;7(2):e30482.
JAZ454 C. elegans jlgEx220. Show Description
jlgEx220 [nep-2p::nep-2(cDNA)::wrmScarlet + elt-2p::GFP::NLS]. Maintain by picking GFP+ (intestinal nuclear). Extrachromosomal array with a red translational reporter for NEP-2 in nep-2 expressing cells, co-injected with a nuclear GFP intestinal marker. Reference: Lo J, et al. Curr Biol. 2024 Oct 21;34(20):4715-4728.e4. doi: 10.1016/j.cub.2024.09.059. PMID: 39395417.
JAZ515 C. elegans nep-2(ok2846) II; jlgEx251. Show Description
jlgEx251 [myo-3p::nep-2(cDNA)::wrmScarlet + elt-2p::GFP::NLS]. Maintain by picking GFP+ (intestinal nuclear). Extrachromosomal array with a red translational reporter for NEP-2 in myo-3 expressing muscle cells, co-injected with a nuclear GFP intestinal marker, in nep-2(ok2846) mutant background. Reference: Lo J, et al. Curr Biol. 2024 Oct 21;34(20):4715-4728.e4. doi: 10.1016/j.cub.2024.09.059. PMID: 39395417.
JH1288 C. elegans cdk-7(ax224) I. Show Description
Temperature sensitive lethal. Maintain at 15C.