Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
OH4128 C. elegans juIs76 II; evIs82b IV. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. evIs82b [unc-129::GFP + dpy-20(+)] IV.
OH4132 C. elegans vab-1(dx31) II; rhIs4 III; wrk-1(ok695) X. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III.
OH4136 C. elegans rhIs4 III; wrk-1(tm1099) X. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III.
OH4770 C. elegans ttx-3(mg158) X; otIs24. Show Description
otIs24 [sre-1::GFP + dpy-20(+)].
OP32 C. elegans unc-119(ed3) III; wgIs32. Show Description
wgIs32 [dpy-27::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
PD3011 C. elegans cyd-1(cc600) II; cup-5(ar465) III; arIs39 X. Show Description
arIs39 [myo-3p::ssGFP + dpy-20(+)].
PD4251 C. elegans ccIs4251 I; dpy-20(e1282) IV. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. This strain produces GFP in all body wall muscles and vulval muscles, with a combination of mitochondrial and nuclear localization. ME0. Heterozygous males mate well. Integrated array (ccIs4251) contains 3 plasmids: pSAK2 (myo-3 promoter driving a nuclear-targeted GFP-LacZ fusion), pSAK4 (myo-3 promoter driving motochondrially targeted GFP), and a dpy-20 subclone. Array rescues dpy-20(e1282ts).
PD4285 C. elegans mls-1(cc569) III; ayIs2 IV. Show Description
ayIs2 [egl-15p::GFP + dpy-20(+)] IV. Adult midbody GFP pattern in 8 vm-1 type muscles (instead of 4 as in WT). mls-1(o) converts uterine to vulval muscles.
PD4443 C. elegans ccIs4443 IV. Show Description
ccIs4443 [arg-1::GFP + dpy-20(+) ]. GFP activity in diverse differentiated non-striated mesodermal lineages. Strain might contain dpy-20(e1282) in background.
PD4655 C. elegans dpy-20(e1282) IV; ccIs4655. Show Description
ccIs4655 [pes-10::GFP + dpy-20(+) ]. GFP expression in lineages with active HLH-8/HLH-2 (e.g., sex muscle, head mesodermal cell). Transgene contains pes-10::GFP reporter driven by 8 copies of an HLH-8/HLH-2 response site from the ceh-24 promoter.
PD4666 C. elegans ayIs6 X. Show Description
ayIs6 [hlh-8::GFP fusion + dpy-20(+)]. GFP expression in M and undifferentiated cells of the M lineage. Strain might carry dpy-20(e1282) in background.
PD4667 C. elegans ayIs7 IV. Show Description
ayIs7 [hlh-8::GFP fusion + dpy-20(+)]. GFP expression in M and undifferentiated cells of the M lineage. Strain might carry dpy-20(e1282) in background.
PD6249 C. elegans ccIs4251 I; tam-1(cc567) V. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. Homozygotes have decreased expression of tandem array transgenes, decreased fertility, and high incidences of males at 25C. Maintain at 15C.
PD8601 C. elegans ccDf1/dpy-25(e817) II. Show Description
Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy.
PD8602 C. elegans ccDf2/dpy-25(e817) II. Show Description
Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy.
PD8603 C. elegans ccDf3/dpy-25(e817) II. Show Description
Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy.
PD8604 C. elegans ccDf4/dpy-25(e817) II. Show Description
Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy.
PD8605 C. elegans ccDf5/dpy-25(e817) II. Show Description
Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy.
PD8607 C. elegans ccDf7/dpy-25(e817) II. Show Description
Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy. Rec'd new stock 8/2000.
PD8611 C. elegans ccDf11/dpy-25(e817) II. Show Description
Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy.
PJ1277 C. elegans ccIs4251 I; unc-51(e369) ccIs55 V. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. ccIs55 [unc-54::lacZ + sup-7(st5)] V. GFP expression in nuclei and mitochondria of muscle cells.
PS1493 C. elegans dpy-20(e1362) IV; syIs9. Show Description
syIs9 [pJMGoQL + (pMH86) dpy-20(+)]. Phenotype of dominant activated Go alpha is lethargic and egg-laying defective - phenotype increases in severity as animal matures and ages. Animals frequently wander to the side of the plate. Animals move with decreased amplitude of sinusoidal waves. Dpy and WT revertants are frequent. Linkage unknown. Do not distribute this strain; other labs should request it from the CGC.
PS1595 C. elegans lfe-2(sy326) I; lin-3(n1058) dpy-20(e1282) IV. Show Description
sy326 suppresses the sterility of n1058. Dpy.
PS1631 C. elegans itr-1(sy290) dpy-20(e1282) IV. Show Description
PS1681 C. elegans dpy-20(e1282) IV; syIs17. Show Description
syIs17 [pJMGoQLHS + (pMH86) dpy-20(+)].
PS1702 C. elegans dpy-20(e1282) IV; syIs20 him-5(e1490) V. Show Description
syIs20 [gpa-1::lacZ + dpy-20(+)] V. Do not distribute this strain; other labs should request it from the CGC.
PS1922 C. elegans dpy-20(e1282) syIs24 IV. Show Description
syIs24 [(pJM3QL) gpa-3(gf) + (pMH86) dpy-20(+)]. pJM3QL is a gain-of-function mutation in gpa-3 Daf-c. Do not distribute this strain; other labs should request it from the CGC.
PS2037 C. elegans syIs12 II. Show Description
syIs12 [hsp::lin-3 + dpy-20(+)]. "low dose" overexpressor of the EGF repeat of lin-3 under control of the heat shock promoter. Wild type vulval differentiation when grown at 20C. Muv phenotype resulting from heat shock at L2 lethargis. Reference: Katz WS, et al. Cell. 1995 Jul 28;82(2):297-307. Do not distribute this strain; other labs should request it from the CGC.
PS2105 C. elegans dpy-20(e1282) IV; syIs13. Show Description
syIs13 [(pJMG2QL) gpa-2(gf) + (pMH86) dpy-20(+)]. pJM3QL is a gain-of-function mutation in gpa-2. Do not distribute this strain; other labs should request it from the CGC.
PS2109 C. elegans dpy-20(e1282) IV; syIs25 X. Show Description
syIs25 [(pJM3QL) gpa-3(gf) + (pMH86) dpy-20(+)]. pJM3QL is a gain-of-function mutation in gpa-3 Daf-c. Do not distribute this strain; other labs should request it from the CGC.
PS2399 C. elegans dpy-20(e1282) IV; syIs30 X. Show Description
syIs30 [(pJMG2QL) gpa-2(gf) + (pMH86) dpy-20(+)]. pJM3QL is a gain-of-function mutation in gpa-2. Do not distribute this strain; other labs should request it from the CGC.
PS2442 C. elegans dpy-20(e1282) IV; syIs44 V. Show Description
syIs44 [hsp-16p::lacI::GFP + lacO(256) + dpy-20(+)] V. Non-Dpy. Upon heat shock, two intense spots of nuclear fluorescence due to lacO in the chromosome, and a diffuse nuclear fluorescence due to nuclear-localized GFP-lacI. Array derived from Fire Lab vector pPD49-78 and dpy-20 rescuing construct pMH86. Do not distribute this strain; other labs should request it from the CGC.
PS2444 C. elegans dpy-20(e1282) IV; syIs36. Show Description
syIs36 [(pLB2) egl-30(+) + pBS + (pMH86) dpy-20(+)]. Integrated version of syEx126 (egl-30 over-expressing line). Easily reverted. Do not distribute this strain; other labs should request it from the CGC.
PS2467 C. elegans dpy-20(e1282) IV; syEx178. Show Description
syEx178 [hsp16.1::egl-5 + (pMH86) dpy-20(+) + pBS]. Heat-shock egl-5. Do not distribute this strain; other labs should request it from the CGC.
PS2746 C. elegans dpy-20(e1282) IV; syEx234. Show Description
syEx234 [let-23::GFP + pBS + (pMH86) dpy-20(+)]. Non-Dpys bear the transgene and express GFP in multiple cells including the pn.ps and uv1. Maintain by picking Non-Dpy. Do not distribute this strain; other labs should request it from the CGC.
PS2767 C. elegans hmg-1.2(sy549) III; dpy-20(e1282) IV; syIs20 him-5(e1490) V. Show Description
syIs20 [gpa-1::lacZ + dpy-20(+)] V. Him. p-Vul. Abnormal secondary vulva lineage defect in 10% of animals. Reduced brood size as well as other pleiotropic defects. Males have ray defect (cannot mate) and SPD sheath to neuron transformation, which can be visualized by lacZ staining in syIs20 [gpa-1::lacZ] background: 1 cell per spicule stains in WT (the SPD neuron) whereas in hmg-1.2(sy549), 2 cells per spicule stain. sy549 previously called son-1. Do not distribute this strain; other labs should request it from the CGC.
PS2943 C. elegans hmg-1.2(sy549) unc-32(e189) III; syIs20 him-5(e1490) V. Show Description
syIs20 [gpa-1::lacZ + dpy-20(+)] V. Unc. Him. p-Vul. Abnormal secondary vulva lineage defect in 10% of animals. Reduced brood size as well as other pleiotropic defects. Males have ray defect (cannot mate) and SPD sheath to neuron transformation, which can be visualized by lacZ staining in syIs20 [gpa-1::lacZ] background: 1 cell per spicule stains in WT (the SPD neuron) whereas in hmg-1.2(sy549), 2 cells per spicule stain. sy549 previously called son-1. Do not distribute this strain; other labs should request it from the CGC.
PS2958 C. elegans syIs46 II; ncl-1(e1865) III; dpy-20(e1282) IV; him-5(e1490) V. Show Description
syIs46 [dpy-30::S65T::lacI + hsp-16p::GFP::lacI + dpy-20(+)] II. Animals are Ncl, Him and Non-Dpy. Heat shock results in diffuse nuclear GFP expression from Fire Lab vector pPD49.78::LacI in most cells. Also see some consitutive GFP expression in embryos from dpy-30 promoter. Do not distribute this strain; other labs should request it from the CGC.
PS3003 C. elegans dpy-20(e1282) ark-1(sy247) IV. Show Description
Dpy. WT vulva at 20C. At 25C, occasional animals with hyperinduced vulva are observed. Do not distribute this strain; other labs should request it from the CGC.
PS3170 C. elegans dpy-17(e164) hmg-1.2(sy549) III; syIs20 him-5(e1490) V. Show Description
syIs20 [gpa-1::lacZ + dpy-20(+)] V. Dpy. Him. p-Vul. Abnormal secondary vulva lineage defect in 10% of animals. Reduced brood size as well as other pleiotropic defects. Males have ray defect (cannot mate) and SPD sheath to neuron transformation, which can be visualized by lacZ staining in syIs20 [gpa-1::lacZ] background: 1 cell per spicule stains in WT (the SPD neuron) whereas in hmg-1.2(sy549), 2 cells per spicule stain. sy549 previously called son-1. Do not distribute this strain; other labs should request it from the CGC.
PS3239 C. elegans dpy-20(e1282) syIs49 IV. Show Description
syIs49 [zmp-1::GFP + (pMH86) dpy-20(+)] IV. Non-Dpy. Expresses GFP in anchor cell at L3 stage. VulA at late L4, and VulE soon thereafter. Do not distribute this strain; other labs should request it from the CGC.
PS3351 C. elegans dpy-20(e1282) syIs17 IV. Show Description
syIs17 [pJMGoQLHS + (pMH86) dpy-20(+)] IV. Non-Dpy animals which at all stages progressively exhibit Go(gf) phenotype after heat shock treatment (standard treatment is 33C water bath for 30 minutes). Animals cease feeding, foraging, locomotion, ovulating and egg laying. Gravid adults eventually bag. "Suicides" are common. Do not distribute this strain; other labs should request it from the CGC.
PS3352 C. elegans syIs50. Show Description
syIs50 [cdh-3::GFP + dpy-20(+)]. Line is a slightly Dpy, but appears healthy. Reference: Pettitt J, et al. Development. 1996 Dec;122(12):4149-57. Do not distribute this strain; other labs should request it from the CGC.
PS4087 C. elegans dpy-22(sy622) X. Show Description
Enhances vulval development in the presence of let-23(sa62gf) in hermaphrodites and males. Animals are Dpy. Hermaphrodites are Egl. Males have abnormal ray development. Do not distribute this strain; other labs should request it from the CGC.
PS4263 C. elegans egl-30(md186) I; dpy-20(e1282) IV; syIs105. Show Description
syIs105 [egl-30::GFP + dpy-20(+)]. Translational fusion contains all of the presumptive 5'-transcriptional regulatory sequences, introns, and presumptive 3 regulatory sequences for egl-30, in addition to the coding sequences for GFP just 5' of the egl-30 initiating methionine. syIs105 was found to partially rescue egl-30(md186) with respect to egg laying, movement, pharyngeal pumping, and response to neurotransmitters in egg-laying assays.
PS4432 C. elegans him-5(e1490) V; dpy-22(sy665) X. Show Description
Enhances vulval development in the presence of let-23(sa62gf) in hermaphrodites and males. Animals are Dpy. Hermaphrodites are Egl. Males have abnormal ray development. Do not distribute this strain; other labs should request it from the CGC.
PS468 C. elegans let-60(sy100) dpy-20(e1282)/let-60(n1046) unc-22(s7) IV; him-5(e1490) V. Show Description
Heterozygotes are weak Muv and segregate weak Muv, Muv Twitchers, and Dpy Vuls whose progeny are larval lethal. sy100 is a dominant negative allele of let-60. n1046 is a gain-of-function allele of let-60. Do not distribute this strain; other labs should request it from the CGC.
PS524 C. elegans let-60(sy100) dpy-20(e1282) IV/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are non-Dpy Vul and segregate non-Dpy Vul, DpyVul whose progeny are dead, and dead eggs. sy100 is dominant Vul and recessive Lethal with maternal rescue: homozygotes from heterozygous mothers grow to adulthood and become a bag of dead larvae. sy100 is not 100% penetrant. Do not distribute this strain; other labs should request it from the CGC.
PS99 C. elegans dpy-20(e1362) IV. Show Description
Severe Dpy. Cold sensitive: grow at 20C. Can be used for microinjection because rescued animals are easier to pick out than dpy-20(e1282) rescued animals. Do not distribute this strain; other labs should request it from the CGC.
RG3104 C. elegans cwc-15(ve604[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC4(s2172) [dpy-21(e428)] V. Show Description
Homozygous larval arrest. Deletion of 1421 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ clear young larvae easiest to see at the edge of the lawn (ve604 homozygotes) and arrested non-GFP (stage unknown) (sC4 homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: aactcatattcaaaactcgcgccgaaatgt ; Right flanking sequence: gtaggccgtatcgacttttcaagtactttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.