Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
RG3311 C. elegans fars-2(ve811[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC4(s2172) [dpy-21(e428)] V. Show Description
Homozygous Ste, Pvl, Unc. Deletion of 3213 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type dim GFP+, and segregate wild-type dim GFP+, bright GFP+ Ste, Pvl, and Unc animals (ve811 homozygotes) and arrested non-GFP (stage unknown, some uncharacterized non-GFP hermaphrodites develop into fertile adults) (sC4 homozygotes). Maintain by picking wild-type dim GFP+. Left flanking Sequence: ggtttttcagtgctcttcgtattacCTCCT ; Right flanking sequence: TTCGTCTTTCGAGTAGAGCCGAACACCTTC. sgRNA #3: TGAAAGAGCACTTACCAAGG; sgRNA #4: CTACTCGGCAAAAAGCCGGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3327 C. elegans T06E6.1(ve827[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC4(s2172) [dpy-21(e428)] V. Show Description
Homozygous early larval arrest. Deletion of 1416 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+  arrested larvae (ve827 homozygotes) and arrested non-GFP (stage unknown) (sC4 homozygotes). Maintain by picking wild-type GFP+.  Left flanking Sequence: CGTCGGATGATTTTTTCGCCCTTTTCACCG; Right flanking sequence: AGGTAATCTCATCGCTTTTCGGGTCAAGGG. T06E6.1 sgRNA #1: CGTGTGGGGAGTGATGGAAC; T06E6.1 sgRNA #2: CTCGTCATTCCAGATCATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3355 C. elegans rpl-38(ve855[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC4(s2172) [dpy-21(e428)] V. Show Description
Homozygous sterile. Deletion of 5417 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type dim GFP+, and segregate wild-type dim GFP+, bright GFP+  sterile (ve855 homozygotes) and arrested non-GFP (stage unknown) (sC4 homozygotes). Maintain by picking wild-type dim GFP+. May grow better at 15C. Left flanking Sequence: GGCTTCAACTATATTTTAATTTTTCAGGTA; Right flanking sequence: GCTCAAGTAGATCAAATCTCTTCTCTGCTC. rpl-38 sgRNA #1: ATCCACCATTGCGATGCCAA; rpl-38 sgRNA #2: TCCTTGACTTGGATGCCTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RV120 C. elegans spe-44(ok1400) dpy-20(e1282)/let-92(s677) unc-22(s7) IV. Show Description
Pick wild-type to maintain.
SD1333 C. elegans ccIs4251 I; stIs10047. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10047 [unc-14p::his-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1340 C. elegans ccIs4251 I; stIs10035. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10035 [eft-3p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1345 C. elegans ccIs4251 I; stIs10077. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10077 [pha-4p(I2L)::his-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1346 C. elegans ccIs4251 I; stIs10088. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10088 [hlh-1p::his-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1347 C. elegans ccIs4251 I; stIs10079. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10079 [unc-54p::his-24::mCherry::let-858 3' UTR + unc-119(+)]. Published in Liu, X., et al., Cell, 2009. 139(6).
SD1395 C. elegans ccIs4251 I; stIs10115. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10115 [egl-5p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1408 C. elegans ccIs4251 I; gaIs218. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. gaIs218 [Y57A10C.6p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1421 C. elegans ccIs4251 I; gaIs222. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. gaIs222 [C54D10.3p::his-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1432 C. elegans ccIs4251 I; gaIs220. Show Description
gaIs220 [col-93p::HIS-24::mCherry + unc-119(+)]. ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. Published in Liu, X., et al., Cell, 2009. 139(6).
SD1433 C. elegans ccIs4251 I; stIs10596. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10596 [ceh-41p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1439 C. elegans ccIs4251 I; gaIs234. Show Description
gaIs234 [jkk-1p::his-24::mCherry + unc-119(+)]. ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. Published in Liu, X., et al., Cell, 2009. 139(6).
SD1453 C. elegans ccIs4251 I; gaIs245. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. gaIs245 [col-34p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1454 C. elegans ccIs4251 I; stIs10117. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10117 [hsp-3p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009) 139(6).
SD1462 C. elegans ccIs4251 I; gaIs209. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. gaIs209 [sod-3p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1468 C. elegans ccIs4251 I; gaIs239. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. gaIs239 [trap-2p::his-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009) 139(6).
SD1471 C. elegans ccIs4251 I; gaIs232. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. gaIs232 [csq-1p::his-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1477 C. elegans ccIs4251 I; gaIs235. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. gaIs235 [csq-1p::his-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009) 139(6).
SD1482 C. elegans ccIs4251 I; gaIs250. Show Description
gaIs250 [M02D8.1p::HIS-24::mCherry + unc-119(+)]. ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. Published in Liu, X., et al., Cell, 2009. 139(6).
SD1485 C. elegans ccIs4251 I; gaIs211. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. gaIs211 [vha-12p::his-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009) 139(6).
SD1505 C. elegans ccIs4251 I; oxIs305 II. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. oxIs305 [dpy-30p::mCherry::HIS-24::unc-54 3'utr + Cbr-unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1542 C. elegans ccIs4251 I; stIs10200. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10200 [hnd-1p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1546 C. elegans ccIs4251 I; stIs10166. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10166 [dpy-7p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1548 C. elegans ccIs4251 I; stIs10172. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10172 [mml-1p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1550 C. elegans ccIs4251 I; stIs10178. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10178 [elt-6p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1551 C. elegans ccIs4251 I; stIs10193. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10193 [nhr-2p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1552 C. elegans ccIs4251 I; stIs10224. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10224 [lin-39p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1553 C. elegans ccIs4251 I; stIs10587. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10587 [lin-26p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1555 C. elegans ccIs4251 I; stIs10691. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10691 [ref-1p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1556 C. elegans ccIs4251 I; stIs10716. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10716 [sma-9gp::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1579 C. elegans ccIs4251 I; stIs10184. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10184 [ceh-49p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009) 139(6).
SD1583 C. elegans ccIs4251 I; stIs10373. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10373 [C50F7.5p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1584 C. elegans ccIs4251 I; stIs10165. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10165 [egl-27p::HIS-24::mCherry + unc-119(+)]. Reference: Liu X, Long F, Peng H, Aerni SJ, Jiang M, Sánchez-Blanco A, Murray JI, Preston E, Mericle B, Batzoglou S, Myers EW, Kim SK. Analysis of cell fate from single-cell gene expression profiles in C. elegans. Cell. 2009 Oct 30;139(3):623-33. doi: 10.1016/j.cell.2009.08.044. PMID: 19879847; PMCID: PMC4709123.
SD1585 C. elegans ccIs4251 I; stIs10187. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10187 [lin-31p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1586 C. elegans ccIs4251 I; stIs10180. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10180 [kin-18p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1588 C. elegans ccIs4251 I; stIs10190. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10190 [C08B11.3p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1590 C. elegans ccIs4251 I; stIs10200. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10200 [die-1p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009) 139(6).
SD1596 C. elegans ccIs4251 I; stIs10430. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10430 [ztf-12p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1611 C. elegans ccIs4251 I; stIs10440. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10440 [ceh-27p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009) 139(6).
SD1614 C. elegans ccIs4251 I; stIs10447. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10447 [ceh-34p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009) 139(6).
SD1628 C. elegans ccIs4251 I; stIs10664. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10664 [unc-130p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1629 C. elegans ccIs4251 I; stIs10524. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10524 [K02G10.1p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1631 C. elegans ccIs4251 I; stIs10656. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10656 [nhr-69p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1633 C. elegans ccIs4251 I; stIs10539. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10539 [dmd-4p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1634 C. elegans ccIs4251 I; stIs10546. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10546 [hlh-16-2p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1635 C. elegans ccIs4251 I; stIs10653. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10653 [nod-1p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1636 C. elegans ccIs4251 I; stIs10671. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10671 [unc-39p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).