Search Strains

pkIs575 [gpc-1::GFP + dpy-20(+)]. Reporter construct includes 4.2 kbp of upstream sequences, and most of the gpc-1 coding region, fused in-frame to GFP. 5.0 kbp XbaI - ScaI fragment cloned into pPD95.77. Reference: Jansen G, et al. EMBO J. 2002 Mar 1;21(5):986-94.

pkIs503[gpa-1XS(+) dpy-20(+)]. Not know to which LG the insertion is attached.

pkIs515 [gpa-4XS(+) + dpy-20(+)]. Not known to which LG the insertion is attached.

pkIs519 [gpa-6XS(+) dpy-20(+)]. Not known to which LG the insertion is attached.

pkIs523 [gpa-7(+) + dpy-20(+)].

pkIs527 [gpa-8XS(+) + dpy-20(+)]. Not know to which LG the insertion is attached.

pkIs531[gpa-9XS(+) dpy-20(+)]. Not known to which LG the insertion is attached.

pkIs539 [gpa-11(XS)(+) + dpy-20(+)]. Not know to which LG the insertion is attached.

pkIs552[gpa-14XS(+) dpy-20(+)]. Not know to which LG the insertion is attached.

pkIs555 [gpa-15XS(+) + dpy-20(+)]. Not know to which LG the insertion is attached.

pkIs571[gpc-1XS dpy-20(+)]. No morphological changes. Locomotion and egg laying are slightly reduced.

pkIs582 [gpa-5::GFP + dpy-20(+)]. Reporter construct includes 4.5 kb upstream and the first 5 exons of gpa-5 fused in frame with GFP. 4.5 kb PstI - BamHI fragment cloned in pPD95.79. Reference: Jansen G, et al. Nat Genet. 1999 Apr;21(4):414-9.

pkIs583 [gpa-6::GFP + dpy-20(+)]. GFP expression in AWA, ASI and PHB. Reference: Jansen G, et al. Nat Genet. 1999 Apr;21(4):414-9.

pkIs584 [gpa-7::GFP + dpy-20(+)]. GFP expression in many neurons, muscle cells, and many neurons in the male tail.

pkIs586 [gpa-9::GFP + dpy-20(+)]. GFP expression in ASJ, PHB, PVQ, pharynx muscle and spermatheca.

pkIs587 [gpa-10::GFP + dpy-20(+)].

pkIs588 [gpa-11::GFP + dpy-20(+)]. Reporter construct includes 3030 bp upstream of ATG to +98 in exon 1 fused in frame with GFP in pPD95.77. Reference: Jansen G, et al. Nat Genet. 1999 Apr;21(4):414-9.

pkIs589 [gpa-13::GFP + dpy-20(+)]. Reference: Jansen G, et al. Nat Genet. 1999 Apr;21(4):414-9.

pkIs590 [gpa-14::GFP + dpy-20(+)]. GFP+.

pkIs591[dpy-20(+) + gap-15::GFP]. GFP expression in ADL, ASH, ASK, PHA, PHB, distal tip cell, anchor cell, and many male-specific neurons.

pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.

pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene.

pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.

pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene.

pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.

pkIs1269 [gpa-13XS(+) + dpy-20(+)].

pkIs1273 [gpa-16::GFP + dpy-20(+)].

pkIs1275 [gpc-2::GFP + dpy-20(+)]. Reporter construct includes 2.3 kbp of upstream sequence and most of the gpc-2 open reading frame. 2.5 kbp PCR fragment generated with primers gpc2-1 (TCTGCAGCACGACGATAATC, extended with a SphI site) and gpc2-2 (GTCGATTGGGTTCACAAGTG, extended with a BamHI site) into vector pPD95.77. Reference: Jansen G, et al. EMBO J. 2002 Mar 1;21(5):986-94.

Pick WT to maintain. The pk1331 allele can be followed by PCR.

pkIs1330 [hsp::gpa-12QL + dpy-20(+)]. Suppressor of activated G12.

pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.

pkIs1330 [hsp::gpa-12QL + dpy-20(+)]. Suppressor of activated G12.

pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Heat-shock conditions are 2 hours at 33C, which results in degeneration of neurons.

pkIs334 [gsa-1(+) + dpy-20(+)]. gsa-1 overexpression. The strain is Egl-c and moves actively.

pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. acy-1 previously called sgs-1.

pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. acy-1 previously called sgs-1.

pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.

arIs37 [myo-3p::ssGFP + dpy-20(+)] I. myo-3p::ssGFP is a secreted GFP that is taken up by coelomocytes. Reference: Gee, K et al. (2017) G3 7: 991.

arIs37 [myo-3p::ssGFP + dpy-20(+)] I. cdIs32 [unc-122p::DT-A(E148D) + myo-2p::GFP + unc-119(+)]. A diphtheria toxin A fragment DT-A (E148D) is expressed under a coelomocyte-specific promoter leading to the absence of coelomocytes. Worms are slightly uncoordinated, slightly dumpy and slow growing. References: Fares H & Greenwald I. Genetics. 2001 Sep;159(1):133-45. doi: 10.1093/genetics/159.1.133. PMID: 11560892. Schwartz MS, et al. PLoS One. 2010 Mar 5;5(3):e9564. doi: 10.1371/journal.pone.0009564. PMID: 20221439.

evIs111 [F25B3.3::GFP + dpy-20(+)]. Pan-neural expression.

evIs41[mec-7::lacZ; mec-7::unc-5; dpy-20(+)] V. Suppresses axon guidance phenotype ofmec-7::unc-5. Has slight Uncoordinated phenotype.

evIs41[mec-7::lacZ; mec-7::unc-5 + dpy-20(+)] V. Suppresses axon guidance phenotype ofmec-7::unc-5. Has slight Uncoordinated phenotype.

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. otIs77 [ttx-3p::kal-1 + unc-122p::GFP] II. ruIs37 [myo-2p::GFP + unc-119(+)] III. jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. vsIs33 [dop-3::RFP] V. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Koppen M, et al. Nat Cell Biol. 2001 Nov;3(11):983-91.

evIs82b [unc-129::GFP + dpy-20(+)] IV. otEx5966 [bnc-1p::mChOpti + pha-1(+)]. Maintain at 25C to select for presence of otEx5966 array. VA/VB motor neuron class-specific red fluorescent reporter. Reference: Kerk SY, et al. Neuron 2017 (in press).

evIs82b [unc-129::GFP + dpy-20(+)] IV. De-repression of ectopic effector genes in VA/VB class motor neurons. Reference: Kerk SY, et al. Neuron 2017 (in press).

evIs82b [unc-129::GFP + dpy-20(+)] IV. De-repression of ectopic effector genes in VA/VB class motor neurons. Reference: Kerk SY, et al. Neuron 2017 (in press).

otIs736 [cat-4p::mCherry + rol-6(su1006)]. evIs111 [F25B3.3::GFP + dpy-20(+)]. Rollers. Pan-neural GFP expression. The two HSN neurons are marked with both GFP and mCherry. Can be used to isolate HSN by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

otIs3 [gcy-7::GFP + lin-15(+)] V. Whole genome sequenced strain.

rhIs4 [glr-1p::GFP + dpy-20(+)] III.

evIs82b [unc-129::GFP + dpy-20(+)] IV.