Search Strains

utsIs4 [nhr-49p::nhr-49::GFP + myo-2p::mCherry]. Strain was back-crossed to N2 following transgene integration (parental strain described in Ratnappan R, et al. PLoS Genet. 2014 Dec 4;10(12):e1004829. doi: 10.1371/journal.pgen.1004829. ). Reference: Watterson A, et al. Nature. 2022 May;605(7911):736-740. doi: 10.1038/s41586-022-04729-7. PMID: 35585236.

Heterozygotes are WT and segregate WT, DpyUncs and Unc larval lethals. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, DpyUncs and Unc larval lethals. Reference null allele for let-23. Do not distribute this strain; other labs should request it from the CGC.

10% of heterozygotes are Muv, 90% are WT. Segregates UncMuv and DpyUncs. Do not distribute this strain; other labs should request it from the CGC.

Heterozgyotes are WT and segregate WT, DpyUncs and Vulvaless Unc-4s. sy97 is only 15% viable. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, DpyUnc and Sterile Unc-4s. sy10 is only 15% viable. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are approximately wild-type in size and Muv. Pick Muv non-Unc (heterozygotes) to maintain.

Unc. Viable allele of let-23. Vul. Do not distribute this strain; other labs should request it from the CGC.

Do not distribute this strain; other labs should request it from the CGC.

umnIs75 [myo-2p::GFP + NeoR, I: 12541645 (intergenic)] I. Heterozygous strain. Crossover suppressor for LGI right. Inversion includes unc-75 and unc-54(h1040). Heterozygotes are wild-type (not paralyzed) with dim GFP expression in pharynx, and segregate heterozygotes (not paralyzed, dim GFP), homozygous wild-type (not paralyzed, no GFP), and hIn1 homozygotes (paralyzed, bright GFP). Pick non-paralyzed, dim GFP worms and check for correct segregation of progeny to maintain. Maintain at 20C or higher: recombined balancer seems more prone to breaking down at low temperatures. Derived cross of parental strains CGC94 (hIn1[umnIs75]) to QP2460 (hIn1[umnIs78, unc-54(h1040)]/+) and selecting for the recombined hIn1 worms.

ZC64.3 Homozygous. Outer Left Sequence: TCGGTCATTTTGGCATGATA. Outer Right Sequence: GCTGACCCCTATTCCCTCAT. Inner Left Sequence: CGATGTTGCGTTCATAGTGG. Inner Right Sequence: CGCCCAAAATTTTTCATCAT. Inner Primer PCR Length: 3110. Estimated Deletion Size: about 2100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R05G6.8 Homozygous. Outer Left Sequence: gctgaaacatgccaaggatt. Outer Right Sequence: tcaaaatgtttctctggccc. Inner Left Sequence: ctatgcgaaagaaagggcag. Inner Right Sequence: tggcgttggtgacaataaaa. Inner Primer PCR Length: 2912. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK1058.1 Homozygous. Diminished ablility to incorporate C14 labled propionate into protein (data provided by Randy Chandler). Outer Left Sequence: cgcgaaaattaacgagaagc. Outer Right Sequence: cagccaattttctgtgggtt. Inner Left Sequence: cggtcttcccaatttcttga. Inner Right Sequence: ttcccaaaatttcgttgctc. Inner Primer PCR Length: 3097. Deletion size: 990 bp. Left flank: TAGTCTCAAAATCAGATATACACAAAAATC. Right flank: ATGGCAAGTACTGGAACGACAGCTCCGTTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y38E10A.5. Homozygous. Outer Left Sequence: AGACACGTAAGCTCGGCAGT. Outer Right Sequence: GCAAAGTCGCAGTTTTCTCC. Inner Left Sequence: TATCAATGGCGAGGCACATA. Inner Right Sequence: TACTGCGGCTGAGAAAACCT. Inner Primer PCR Length: 2826 bp. Deletion Size: 1610 bp. Deletion left flank: CTTCTATTTATGTTATTTGTCTTTTGAACT. Deletion right flank: GCAAGTGCCGAAAATTTCCAAAACCAGAAATTGCCGAAATTGCCGATTGCCGGAAATTT TAAAAACAGAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T27E9.9 Homozygous. Outer Left Sequence: cgtcctcgccattctcttag. Outer Right Sequence: tttcgccaaaattatctccg. Inner Left Sequence: atccgaggacacagatttgg. Inner Right Sequence: tggccttcgttgtcttcttt. Inner Primer PCR Length: 3018. Deletion size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC84.3 Homozygous. Outer Left Sequence: cttgggaaaccttgtcgtgt. Outer Right Sequence: caaacatttccctttttggc. Inner Left Sequence: caaagaaagacccgtttcca. Inner Right Sequence: tgcaaatatgttccaatcaataca. Inner Primer PCR Length: 1312. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C27H5.8. Homozygous. Outer Left Sequence: tcagcaccttcactgattgc. Outer Right Sequence: ttcccgaccactaggtatgc. Inner Left Sequence: cgacacattgtacagacccg. Inner Right Sequence: gcacctccaccacaggttat. Inner primer WT PCR product: 3279. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 1058 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tatttttaaagtaatttcagaATGTTGAAC ; Right flanking sequence: GCATTTGATGAGCCAGCTCCAGGTCATCAA. sgRNA #1: aatttcagaATGTTGAACGT; sgRNA #2: GCTGGCTCATCAAATGCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 6712 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve745 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tgggaataattttctctcgaatcaatatct ; Right flanking sequence: tttaattttttaaagttaaaaattttctag. sgRNA #1: atgaaacttgcacttcaccg; sgRNA #2: aagcggagtcgggaagaggg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Aldicarb resistant.

stIs11622 [unc-4::H1-wCherry + unc-119(+)].

zcIs4 [hsp-4::GFP] V. Animals contain a missense mutation (G739R) in the kinase domain of ire-1. They are unable to induce hsp-4(BiP0 in response to tumincamycin, or heat shock.

zdIs5 [mec-4p::GFP + lin-15(+)] I. mec-4::GFP is expressed in touch neurons.

Heterozygotes are WT with major GFP signal in pharynx. Segregates Dpy GFP+ mIn1 homozygotes and GFP- DpyUncs.

Heterozygotes are WT with major GFP signal in pharynx. Segregates Dpy GFP+ mIn1 homozygotes and GFP- Uncs which are viable but lay oocytes (lay viable embryos if mated to WT males). Strain has a Him phenotype. 3.4% males. Mutant males have abnormal sperm. Class 1 suppressor.

Heterozygotes are WT with major GFP signal in pharynx. Segregates Dpy GFP+ mIn1 homozygotes and GFP- Uncs which are viable but lay inviable embryos (lay viable embyros if mated to WT males). Strain has a Him phenotype. 0.4% males. Mutant males are fertile. Class 2 suppressor.

Bacteria. E. coli carrying pAG607 (orn-1 RNAi feeding vector) for SILAC. Arg-, Lys-, AmpR, TetR. argA, lysA, mcrA, mcrB, IN(rrnD-rrnE)1, lambda-, rnc14::Tn10(DE3 lysogen::lavUV5 promoter -T7 polymerase). Resistant to ampicillin and tetracycline. Reference: Larance M, et al. Nat Methods. 2011 Aug 28;8(10):849-51. Biosafety Level: BSL-1.

Hets are WT and segregate WT, Unc-4 and paralysed DpyUnc (mnC1). Maintain by picking WT.

Hets are WT and segregate WT, dead eggs, paralyzed DpyUnc and males. Maintain by picking WT.

Maintain strain by picking WT hermaphrodites. Segregates WT, dead eggs, paralysed DpyUnc and males.

Hets are WT and segregate WT, paralysed DpyUnc, L1 Lethal Unc-4s and males. Maintain by picking WT.

Hets are WT and segregate WT, dead eggs, paralysed DpyUnc and males. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc, Sterile Unc-4, and males. Maintain by picking WT.

Hets are WT and segregate WT, Sterile Unc-4, and paralysed DpyUnc. Maintain by picking WT.

Hets are WT and segregate WT, Sterile Unc-4, and paralysed DpyUnc. Maintain by picking WT. mn63 pka spe-2. See also WBPaper00003405 and #3406.

Het are WT and segregate WT, paralysed DpyUnc, and dead eggs. Maintain by picking WT.

Hets are WT and segregates WT, paralysed DpyUnc, and larvae which are arrested. Pick L1-L2 Unc-4's to check for larval lethal phenotype. Maintain strain by picking WT

Pick WT to maintain. Hets segregate WT, DpyUncs, and lethals (early larval arrest).

Hets are WT and segregate WT, paralysed DpyUncs, and dead eggs. Pick WT to maintain.

Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Maintain by picking WT.

Hets are WT and segregate WT, dead eggs and paralysed DpyUnc. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and early larval lethals which are Unc. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Maintain by picking WT.

Hets are WT and segregate WT, DpyUnc and UncLets. Lethal early larval. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc, and Lets.

Hets are WT and segregate WT, paralysed DpyUnc and lets.

Maintain by picking WT. Segregates WT (hets with the duplication), paralyzed Unc (hets without the duplication or unc-4 unc-52 homozygotes without the duplication), DpyUnc (mnC1 dpy-10 unc-52 homozygotes without the duplication), Dpy (mnC1 dpy-10 unc-52 homozygotes with the duplication), and Unc-4 (unc-4 unc-52 with the duplication).

Maintain by picking WT. Segregates WT (hets with the duplication), paralyzed Unc (hets without the duplication or unc-4 unc-52 homozygotes without the duplication), DpyUnc (mnC1 dpy-10 unc-52 homozygotes without the duplication), Dpy (mnC1 dpy-10 unc-52 homozygotes with the duplication), and Unc-4 (unc-4 unc-52 with the duplication).

Maintain by picking WT. Segregates WT (hets with the duplication), paralyzed Unc (hets without the duplication or unc-4 unc-52 homozygotes without the duplication), DpyUnc (mnC1 dpy-10 unc-52 homozygotes without the duplication), Dpy (mnC1 dpy-10 unc-52 homozygotes with the duplication), and Unc-4 (unc-4 unc-52 with the duplication).