More Fields
Strain Species Genotype
RB1660 C. elegans clec-4(ok2050) II. Show Description
Y38E10A.5. Homozygous. Outer Left Sequence: AGACACGTAAGCTCGGCAGT. Outer Right Sequence: GCAAAGTCGCAGTTTTCTCC. Inner Left Sequence: TATCAATGGCGAGGCACATA. Inner Right Sequence: TACTGCGGCTGAGAAAACCT. Inner Primer PCR Length: 2826 bp. Deletion Size: 1610 bp. Deletion left flank: CTTCTATTTATGTTATTTGTCTTTTGAACT. Deletion right flank: GCAAGTGCCGAAAATTTCCAAAACCAGAAATTGCCGAAATTGCCGATTGCCGGAAATTT TAAAAACAGAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807