More Fields
Strain Species Genotype
AG150 C. elegans apc-1(ar104)/unc-4(e120) bli-1(e769) II. Show Description
Heterozygotes are WT and segregate WT, UncBli, and Steriles which have an everted vulva. ar104 previously called evl-22 and mat-2.
AG168 C. elegans fzy-1(av15) unc-4(e120) II. Show Description
Unc. Gain-of-function allele of fzy-1.
AG226 C. elegans rol-6(e187) unc-4 (e120)/mnC1 [dpy-10(e128) unc-52(e444) nIs190 let-?] II; him-8(e1489) IV. Show Description
nIs190 [myo-2::GFP]. Him. Heterozygotes are wild-type GFP+ and segregate WT GFP+ heterozygotes, Rol Uncs, dead embryos, and males. nIs190 [myo-2::GFP] integrated in or near mnC1. Approx 0.5% recombination seen between nIs190 and mnC1. Fails to complemement all markers on mnC1.
AH286 C. elegans unc-4(e120) ect-2(zh8) II; gap-1(ga133) X. Show Description
Muv and Unc. Semi-dominant mutation in ect-2 (previously called let-21).
AH346 C. elegans dep-1(zh34) unc-4(e120) II; lip-1(zh15) IV. Show Description
Pvl and weak Muv. Transformation of secondary to primary vulval cell fates.
AMH55 C. elegans daf-2(e1370) III; otIs117 IV. Show Description
otIs117 [unc-33p::GFP + unc-4(+)] IV. Maintain at 15C. Temperature-sensitive dauer constitutive. Pan-neuronal GFP.
AML470 C. elegans juSi164 unc-119(ed3) III; wtfIs458. Show Description
juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfIs458 [mec-4::Chrimson4.2::SL2::mCherry::unc-54 3' UTR + unc-122::GFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Upon blue light treatment (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), Histone-miniSOG in the germline can induce heritable mutations. Transgenic animals express light-gated ion channel Chrimson and a fluorescent protein mCherry in mechanosensory neurons alongside GFP in coelomocytes.
AN170 C. elegans aff-1(ty4) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT (heterozygotes), Unc-4 worms which are strong Egl (ty4 homozygotes), and paralyzed Dpy Uncs (mnC1 homozygotes).
AT28 C. elegans kyIs140 I; srf-6(yj13) unc-4(e120) II. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. Kinker; can't back up. srf-6 mutants express str-2::GFP in both AWC neurons (2AWC ON phenotype; wild-type phenotype is 1AWC ON): check for this phenotype to avoid reversion of srf-6(yj13). srf-6 mutants were originally identified by binding of an L1-specific antibody in later larval stages (L1-L4).
AT30 C. elegans kyIs140 I; nsy-1(ok593) unc-4(e120) II. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. nsy-1(ky593) has no visible phenotype, but can be tracked by linked Unc-4 phenotype (Kinker, can't back up). str-2::GFP is expressed in both AWC neurons.
ATU2301 C. elegans aceIs1; goeIs3. Show Description
goeIs3 [myo-3p::SL1::GCamP3.35::SL2::unc54 3'UTR + unc-119(+)]. aceIs1 [myo-3p::mitochondrial LAR-GECO + myo-2p::RFP]; likely inserted into LG II. Reporter expresses the calcium indicator cytosolic GCaMP3 and mitochondrial LAR-GECO in all body wall muscles.
BA1061 C. elegans dpy-18(e364) spe-6(hc49) ale-1(mc14)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Sterile Dpys (Dpy is temperature sensitive), and dead eggs. ale-1 is a recessive embryonic lethal.
BA14 C. elegans fer-14(hc14) X. Show Description
Temperature sensitive. 8% of total oocytes produced are fertilized and give rise to larvae at 16C. Almost completely sterile at 25C.
BA24 C. elegans fer-1(hc24) I. Show Description
Fertilization abnormal. Recessive. Leaky temperature sensitive.
BA34 C. elegans fer-7(hc34) I. Show Description
Fertilization abnormal. Recessive. Temperature sensitive. Maintain at 15C. Very leaky: grows at 20C and also somewhat at 25.4C to 25.8C.
BC11853 C. elegans dpy-5(e907) I; sEx11853. Show Description
sEx11853 [rCes ZC64.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC11856 C. elegans dpy-5(e907) I; sEx11856. Show Description
sEx11856 [rCesCD4.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC12767 C. elegans dpy-5(e907) I; sIs11856. Show Description
sIs11856 [rCes CD4.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC13862 C. elegans dpy-5(e907) I; sEx13862. Show Description
sEx13862[rCesZC84.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC14263 C. elegans dpy-5(e907) I; sEx14263. Show Description
sEx14263 [rCes CD4.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC14829 C. elegans dpy-5(e907) I; sEx14829. Show Description
sEx14829 [rCes Y57A10C.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BE44 C. elegans dpy-8(sc44) X. Show Description
Temperature sensitive. Left hand Roller and Dpy at 25C. Wild-type at 16C. Recessive.
BW2063 C. elegans ceh-20(ay38) unc-36(e251) III; svDp1 (III;f). Show Description
May have unc-4(e120) mutation in background. svDp1 balances from pal-1 through unc-36 on III. svDp1 made by fusing array containing [unc-4(+) + sur-5::GFP] to sDp3(III;f).
BXN653 C. elegans scrm-1(cjn26) zdIs5 I. Show Description
zdIs5 [mec-4::GFP + lin-15(+)] I. mec-4::GFP is expressed in touch neurons. Null allele of scrm-1: 2501 bp deletion and 7 bp insertion (CACACAT) removes the entire scrm-1 coding sequence (position 11688933 - 11691433 of chromosome I).
CB120 C. elegans unc-4(e120) II. Show Description
Uncoordinated. May contain a weak daf-2 mutation (sa875). See Ailion and Thomas in Genetics 165: 127-144 2003.
CB1339 C. elegans mec-4(e1339) X. Show Description
Mechanosensory abnormal. Scored with difficulty. Sometimes sensitive in the tail. M-MATING++ 1-10%WT.
CB1600 C. elegans tra-2(f70) II. Show Description
Transforms XX to males. Variable expression. Masculinized self-fertile hermaphrodite. tra-2(f70) was crossed into the N2 background to construct a dpy-10 tra-2 unc-4 triple mutant, then crossed to remove the flanking dpy and unc (Jonathan Hodgkin).
CB1611 C. elegans mec-4(e1611) X. Show Description
Mechanosensory abnormal. Touch insensitive. Dominant. Cells become vacuolated and die.
CB2597 C. elegans tra-2(e1098)/dpy-10(e128) unc-4(e120) II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and males. Maintain by picking WT hermaphrodites.
CB2754 C. elegans tra-2(e1095)/dpy-10(e128) unc-4(e120) II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and males. Maintain by picking WT.
CB2830 C. elegans tra-2(e1209)/dpy-10(e128) unc-4(e120) II. Show Description
Balances well. Transformer weak. Heterozygotes are WT and segregate WT, DpyUnc and males. Maintain by picking WT.
CB3274 C. elegans lon-2(e678) mec-4(e1497) X. Show Description
Long. Mechanosensory abnormal.
CB3970 C. elegans unc-4(e120) bli-1(e769) II. Show Description
Uncoordinated and Blistered.
CB4050 C. elegans tra-2(e2046e2115) unc-4(e120) II; sup-7(st5) X. Show Description
Phenotypically wildtype XX hermaphrodite at 20C; poor viability and fertility at 25C. Rare XO animals are hermaphrodite due to suppression of amber mutation e2115 and consequent transformation of XO due to tra-2(e2046) gain-of-function. Reference: Hodgkin & Albertson (1995) PMID: 8647390.
CB4118 C. elegans unc-32(e189) ooc-4(e2078)/eDf2 III. Show Description
Heterozygotes are WT and segregate WT, Uncs which are sterile and dead eggs (eDf2 homozygotes). Strain breaks down very rarely.
CB4330 C. elegans unc-4(e2309) II. Show Description
Reference:
CB5023 C. elegans tra-2(e2046e253) unc-4(e120) / + + II; dpy-26(n199) IV. [XO females, dpy-26 XO males] Show Description
Obligate XO male/female strain, propagate by crossing. Low fertility. Fertile XO females and XO males; inviable XX embryos and larvae. Reference: Strain 7 Hodgkin (2002) PMID: 12399387.
CB5310 C. elegans unc-4(e120) II; lon-2(e678)^lon-2(e678) X. Show Description
Attached X strain with autosomal unc-4 marker, which facilitates test-crosses. Uncoordinated Long hermaphrodites, reduced fertility with many X^X X^X unhatched eggs. Reference: Hodgkin & Albertson (1995) PMID: 8647390.
CB5584 C. elegans mIs12 II. Show Description
mIs12 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP] II. Hermaphrodites expressing compound GFP reporter (see PD4790). Strong pharyngeal muscle expression, easily scored by GFP dissecting scope. mIs12 is tightly linked to unc-4 II, and not to LG III or IV as previously reported. mIs12 homozygous males mate well (ME3).
CE1857 C. elegans ect-2(e1778)/unc-4(e120) sqt-1(sc13) II. Show Description
Heterozygotes are WT and segregate WT, Roller Uncs, and ect-2 homozygotes (sterile Uncs which reach adulthood, sometimes giving polynucleate oocytes). ect-2 pka let-21. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CGC135 C. elegans let-7(umn45[let-7p::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR])/tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X. Show Description
tmIs1240 [myo-2p::venus, X: F23D12.4] X. Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous let-7 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type GFP+ mScarlet+ and segregate wild-type GFP+ mScarlet+ heterozygotes, mScarlet+ non-GFP dead larvae (umn45 homozygotes) and Mec(Unc) non-mScarlet GFP+ (tmC24 homozygotes). Maintain by picking wild-type GFP+ mScarlet+. Left Flanking: GCAAGCAGGCGATTGGTGGACGGTC, Right Flanking: AGCTGCGTCGTCTTGCTCTCACAAc. sgRNA: AAAATTGCATAGTTCACCGG.
CGC17 C. elegans unc-4(e120)/mT1 [umnIs6] II; dpy-17(e164)/mT1 [dpy-10(e128)] III. Show Description
umnIs6 [eft-3p::NLS::tdTomato + HygroR, III:~5753000 (intergenic)] II. Heterozygotes are WT with dim red fluorescence, and segregate WT with dim red fluorescence, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes with more intense red fluorescence), and DpyUnc with no red fluorescence. Pick WT with dim red fluorescence and check for correct segregation of progeny to maintain.
CGC24 C. elegans umnIs13 X. Show Description
umnIs13 [myo-2p::GFP + NeoR, X: 6745526 (intergenic)] X. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.
CGC34 C. elegans eT1 [umnIs12] III; eT1 V. Show Description
umnIs12 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] III. Derived by insertion of myo-2p::GFP transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.
CGC43 C. elegans unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444) umnIs32] II. Show Description
umnIs32 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Hets are WT GFP+ and segregate WT GFP+, Unc-4 (GFP-) and paralysed DpyUnc GFP+ (mnC1 homozygotes). Maintain by picking WT GFP+. Derived by insertion of myo-2p::GFP transgene into mnC1 balancer in parental strain SP127 using CRISPR/Cas9.
CGC44 C. elegans mIn1 [dpy-10(e128) umnIs33]/unc-4(e120) II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, Unc-4 non-GFP, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into mIn1 balancer in parental strain DR1785 using CRISPR/Cas9.
CGC45 C. elegans unc-4(e120)/mT1 [umnIs34] II; mT1 [dpy-10(e128)]/dpy-17(e164) III. Show Description
umnIs34 [myo-2p::GFP + NeoR, III: 8856215 (intergenic)] II. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc non-GFP, sterile Dpy GFP+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into mT1 balancer in parental strain DR1832 using CRISPR/Cas9.
CGC48 C. elegans unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Hets are WT mKate2+ and segregate WT mKate2+, Unc-4 (no red fluorescence) and paralysed DpyUnc mKate2+ (mnC1). Maintain by picking WT mKate2+. Derived by insertion of myo-2p::mKate2 transgene into parental strain SP127 using CRISPR/Cas9.
CGC53 C. elegans mIn1 [dpy-10(e128) umnIs43]/unc-4(e120) II. Show Description
umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2, Unc-4 non-mKate2, and Dpy mKate2+ mIn1 homozygotes. Maintain by picking wild-type mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into mIn1 balancer in parental strain DR1785 using CRISPR/Cas9.
CGC54 C. elegans umnIs44 II. Show Description
umnIs44 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Derived by insertion of myo-2p::mKate2 transgene into parental strain N2 using CRISPR/Cas9.