Search Strains

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

cp189[mrck-1::GFP::3xFlag]. GFP inserted at the C terminus of endogenous mrck-1 gene by Cas9-triggered homologous recombination. Floxed selection cassette was subsequently removed by Cre/Lox recombination leaving a LoxP scar after the 3'UTR. GFP expression in early embryos, larvae, and adults. Reference: Marston DJ, et al. Curr Biol. 2016 26:2079-2089.

mNG and 3xFlag tags inserted into the C-terminus of the endogenous lin-3 locus.

cpIs89 [wrt-2p::2x mTurquoise2::PH::tbb-2 3'UTR loxN] I. cpIs85 [egl-20p::2x mKate2::PH::3xHA::tbb-2 3'UTR loxN] II. mNeonGreen::3xFlag tag inserted at the C-terminus of the endogenous egl-20 locus. 2x mTurquoise2::PH membrane marker expressed in seam cells, Q neuroblasts, and many hypodermal cells. Expression of 2x mKate2::PH membrane marker driven by egl-20 upstream intergenic sequence. cpIs89 is a single copy transgene inserted at Chr I:2851088 near ttTi4348 using Cas9-triggered homologous recombination. cpIs85 is a single copy transgene inserted at Chr II:8420157-8420243 near ttTi5605 using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP fusion. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

cpIs158 [myo-3p::pat-3sp::2x vhhGFP4::CD8 tm::2x mTurquoise2::PH::tbb-2 3'UTR loxN] I. cpIs130 [wrt-2p::2x mKate2::PH::3xHA::let-858 3'UTR::tag-168p::HisCl1::tbb-2 3'UTR loxN] II. YPET::3xFlag tag inserted at the C-terminus of the endogenous egl-20 locus. cpIs158 expresses a membrane-anchored anti-GFP nanobody (Morphotrap) in body wall muscles. This version of Morphotrap consists of extracellular 2x vhhGFP4 fused to a human CD8 transmembrane domain and intracellular 2x mTurquoise2. Endogenously tagged EGL-20::YPET::3xFlag is efficiently sequestered by the Morphotrap transgene (the transgene functions as expected for Wnt), leading to Q neuroblast migration defects. NOTE: cpIs158/Morphotrap does not capture all YPET-tagged extracellular proteins, so sequestration should be determined empirically. cpIs130 is a single copy transgene expressing a 2x mKate2::PH membrane marker in seam cells, Q neuroblasts, and many hypodermal cells, and HisCl1 expression from the tag-168 upstream intergenic sequence. Expression of HisCl1 from the single copy insertion does not appear to be sufficient for immobilizing animals. cpIs158 was inserted at Chr I:2851088 near ttTi4348 using Cas9-triggered homologous recombination. cpIs130 was inserted at Chr II:8420157-8420243 near ttTi5605. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.

Endogenous cycl-2 locus tagged with mNeonGreen (mNG). Green fluorescence in sperm. Him. Reference: Krauchunas AR, et al. (2020). C. elegans CYLC-2 localizes to sperm. microPublication Biology. 10.17912/micropub.biology.000314.

risIs33 [K03A1.5p::3xFLAG::SV40-NLS::dCas9::SV40-NLS::VP64::HA + unc-119(+)]. risIs33 transgene stably expresses a 171 kDa dCas9::VP64 fusion protein suitable for CRISPR activation (CRISPRa) in C. elegans, as described in Fischer F, et al. J Biol Chem. 2022 May 27;102085. doi: 10.1016/j.jbc.2022.102085. PMID: 35636511.

risIs33 [K03A1.5p::3xFLAG::SV40-NLS::dCas9::SV40-NLS::VP64::HA + unc-119(+)]. risIs33 transgene stably expresses a 171 kDa dCas9::VP64 fusion protein suitable for for CRISPR activation (CRISPRa) in C. elegans, as described in Fischer F, et al. J Biol Chem. 2022 May 27;102085. doi: 10.1016/j.jbc.2022.102085. PMID: 35636511. Derived by crossing parental strains MIR249 and ZG31.

risIs33 [K03A1.5p::3xFLAG::SV40-NLS::dCas9::SV40-NLS::VP64::HA + unc-119(+)]. risIs33 transgene stably expresses a 171 kDa dCas9::VP64 fusion protein suitable for for CRISPR activation (CRISPRa) in C. elegans, as described in Fischer F, et al. J Biol Chem. 2022 May 27;102085. doi: 10.1016/j.jbc.2022.102085. PMID: 35636511. Derived by crossing parental strains MIR249 and PS3551.

risIs33 [K03A1.5p::3xFLAG::SV40-NLS::dCas9::SV40-NLS::VP64::HA + unc-119(+)]. gpIs1 [hsp-16.2p::GFP]. Inducible GFP fluorescence after >1 hour heat shock at 35C. risIs33 transgene stably expresses a 171 kDa dCas9::VP64 fusion protein suitable for for CRISPR activation (CRISPRa) in C. elegans, as described in Fischer F, et al. J Biol Chem. 2022 May 27;102085. doi: 10.1016/j.jbc.2022.102085. PMID: 35636511. Derived by crossing parental strains MIR249 and TJ375.

GFP::3xFLAG tags inserted at N-terminus of endogenous lin-45 locus. Wild-type morphology. Reference: Townley R, et al. Sci Signal. 2023 Aug 29;16(800):eabq4355. doi: 10.1126/scisignal.abq4355. PMID: 37643243.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous pash-1 tagged with the auxin-inducible-degron (AID*) peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and soma. Animals are superficially wild-type; addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer et al. Curr Biol. 2020 Dec 21;30(24):5058-5065.e5. doi: 10.1016/j.cub.2020.09.066. Epub 2020 Oct 29. PMID: 33125867.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID*) peptide. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and soma. Animals are superficially wild-type; addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer et al. Curr Biol. 2020 Dec 21;30(24):5058-5065.e5. doi: 10.1016/j.cub.2020.09.066. Epub 2020 Oct 29. PMID: 33125867.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID*) peptide. Endogenous pash-1 tagged with the AID* peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in soma and germ line. Animals are superficially wild-type, addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer et al. Curr Biol. 2020 Dec 21;30(24):5058-5065.e5. doi: 10.1016/j.cub.2020.09.066. Epub 2020 Oct 29. PMID: 33125867.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. lucIs20 [mir-35p::mirtron-35 + myo-2::mCherry]. lucIs24 [mir-52p::mirtron-51 + elt-2::dsRed + myo-2::mCherry]. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID*) peptide. Endogenous pash-1 tagged with the AID* peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in soma and germline. In addition, strain expresses mirtron-versions of mir-35 and mir-51, which are processed independently of Drosha and Pasha. miRNA biogenesis can be stringently inhibited via simultaneous removal of Drosha and Pasha, causing absence of all canonical miRNAs and embryonic lethality upon Auxin treatment. Reference: Dexheimer et al. Curr Biol. 2020 Dec 21;30(24):5058-5065.e5. doi: 10.1016/j.cub.2020.09.066. Epub 2020 Oct 29. PMID: 33125867.

oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + Cbr-unc-119(+)]. lucEx1311 (myo-3p::R2pH::LAMP1::3xFLAG::unc-54 3’UTR + ttx-3p::mCherry). Pick mCherry+ to maintain. Reference: Gutierrez-Perez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.

wdEx637 [dat-1::3xFLAG::pab-1 + unc-119(+)]. Pick non-Unc to maintain. Reference: Spencer WC, et al. Genome Res. 2011 Feb;21(2):325-41.

wdEx257 [unc-4::3XFLAG::pab-1 + (pSV17) unc-119 minigene]. Animals exhibit slight forward movement defect. Good antibody staining witih anit-FLAG M2 antibody (Sigma). 100% penetrant array. Expressed in all unc-4 neurons. Ectopically expressed in at least one head neuron (dorsal to pharynx, between two bulbs).

wgIs652 [fkh-8::TY1::EGFP::3xFLAG + unc-119(+)]. CRISPR-engineered allele of daf-19 affects only isoforms a and b. De-repression of fkh-8 expression in neurons. Reference: Brocal-Ruiz R, et al. Elife. 2023 Jul 14;12:e89702. doi: 10.7554/eLife.89702. PMID: 37449480.

CRISPR/Cas9-engineered insertion of GFP::3xflag::AID* tags into endogenous unc-59/septin locus. Reference: Chen D et al. MicroPubl Biol. 2019 Dec 20;2019:10.17912/micropub.biology.000200. doi: 10.17912/micropub.biology.000200. PMID: 32550451.

mNG and 3xFlag tags inserted into the endogenous unc-6 locus. Superficially wild-type. Reference: Naegeli KM, et al. Dev Cell. 2017 Nov 20;43(4):403-417.e10. doi: 10.1016/j.devcel.2017.10.024. PMID: 29161591

ltSi539 [dlg-1p(delta)7::mCherry::his-72::unc-54 3’UTR + cnd-1p::mCherry::his-72::unc-54 3’UTR + Cbr-unc-119(+)] II. ltSi507 [hlh-1p::GFP::his-72::tbb-2 3’UTR + hlh-1p::mCherry::his-72::tbb-2 3’UTR +Cbr-unc-119(+)] IV. stIs10389 [pha-4::TGF(3E3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. During embryogenesis, ectoderm fluoresces red, mesoderm fluoresces yellow, and endoderm/pharynx fluoresces green. Reference: Wang S, et al. Development. 2019 Apr 11;146(7):dev174029. doi: 10.1242/dev.174029. PMID: 30890570.

mNeonGreen and Flag tags inserted at 5' end of endogenous mdf-1 locus using CRISPR/Cas9 engineering. gRNA sequence: tgattgcattaaacatatt Reference: Kim T, et al. Genes Dev. 2017 Jun 1;31(11):1089-1094. doi: 10.1101/gad.302067.117. PMID: 28698300.

GFP tag inserted at 5' end of endogenous san-1 locus using CRISPR/Cas9 engineering. gRNA sequence: taaaataatatgtataaac

mNeonGreen and Flag tags inserted at 3' end of endogenous cyb-1 locus using CRISPR/Cas9 engineering. gRNA sequence: atgcgtccacttttgcattc Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.

mNeonGreen and Flag tags inserted at 5' end of endogenous cyb-3 locus using CRISPR/Cas9 engineering. Strain has lethality and brood size defects. gRNA sequence: tgaagtcaggtcgacattct Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.

CRISPR/Cas9 engineered. Tagged MDF-1 at its endogenous locus with mScarlet. gRNA sequence: tgattgcattaaacatatt Reference: Lara-Gonzalez P, et al. Science. 2021 Jan 1;371(6524):64-67. doi: 10.1126/science.abc1424. PMID: 33384372.

drSi2 [vha-6p::3XFLAG::pgp-3/CFTR(wt)::mCherry::unc-54 3'UTR] II. Superficially wild-type with mCherry expression only in the intestine with enrichment at the apical membrane. Single copy integration of the vha-6 promoter driving the PGP-3 protein with an N-terminal 3XFLAG tag and a C-terminal mCherry tag. Amino acids 476-484 of PGP-3 have been replaced with amino acids 501-509 of human CFTR (TIKENIIFG). Transgene was inserted at the ttTi5605 locus on LGII and verified to be a single copy insertion by long range PCR across the genomic locus. Reference: He L, et al. Dis Model Mech. 2012 Nov;5(6):930-9.

drSi4 [vha-6p::3XFLAG::pgp-3/CFTR(delta F508)::mCherry::unc-54 3'UTR] II. Superficially wild-type with mCherry expression only in the intestine with significantly diminished expression as compared to drSi2. Single copy integration of the vha-6 promoter driving the PGP-3 protein with an N-terminal 3XFLAG tag and a C-terminal mCherry tag. Amino acids 476-484 of PGP-3 have been replaced with amino acids 501-509 of human CFTR with F508 deleted (TIKENII_G). Transgene was inserted at the ttTi5605 locus on LGII and verified to be a single copy insertion by long range PCR across the genomic locus. Reference: He L, et al. Dis Model Mech. 2012 Nov;5(6):930-9.

CRISPR allele of daf-16, tagged at the C-terminus with mKate2::3xFLAG. Reference: Aghayeva U, et al. A panel of fluorophore-tagged daf-16 alleles. microPublication Biology.

mNeonGreen tag inserted into endogenous daf-16 locus; AID* at 3' end of mNeonGreen. Transgene can be degraded in a background expressing TIR1 co-factor and supplemented with auxin, allowing conditional knock-down of daf-16 expression. Reference: Bhattacharya et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. PMID: 30686580

ot856 [che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 tagged with GFP. Nuclear GFP localization in ASE neurons. Reference: Leyva-Díaz E, et al. Genetics. 2017 Oct;207(2):529-545.

Superficially wildtype. GFP tag inserted into endogenous daf-12 locus through CRISPR/Cas9 engineering. Reference: Aghayeva et al., submitted