Search Strains

ltSi386 [hcp-3p::GFP::hcp-3(re-encoded) + Cbr-unc-119(+)] I. ltSi242 [csr-1p::csr-1(re-encoded; D606A, D681A: isoform b numbering) + Cbr-unc-119(+)] II. The hcp-3 and csr-1 coding sequences in the transgenes were re-encoded for RNAi-resistance (see Gerson-Gurwitz A, et al. Cell. 2016, Supplementary Figure S3A). [NOTE: it is not known if unc-119(ed3) is still present in the background of this strain.] Reference: Gerson-Gurwitz A, et al. Cell. 2016 Apr 7;165(2):396-409.

ltSi386 [hcp-3p::GFP::hcp-3(re-encoded) + Cbr-unc-119(+)] I. The hcp-3 coding sequence in the transgene was re-encoded for RNAi-resistance (see Gerson-Gurwitz A, et al. Cell. 2016, Supplementary Figure S3A). [NOTE: it is not known if unc-119(ed3) is still present in the background of this strain.] Unc worms are heterozygous for csr-1(tm892), non-Unc worms are homozygous for csr-1(tm892). Reference: Gerson-Gurwitz A, et al. Cell. 2016 Apr 7;165(2):396-409.

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. qaIs3502[pie-1::YFP::LMN-1 + unc-119(+)].

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. qaIs3546 [pie-1p::GFP::npp-8 + unc-119(+)]; npp-8 is CeNup155.

ltSi240 [csr-1p::csr-1(re-encoded) + Cbr-unc-119(+)] II. The csr-1 coding sequence in the transgene was re-encoded for RNAi-resistance (see Gerson-Gurwitz A, et al. Cell. 2016, Supplementary Figure S3A). [NOTE: it is not known if unc-119(ed3) is still present in the background of this strain.] Reference: Gerson-Gurwitz A, et al. Cell. 2016 Apr 7;165(2):396-409.

ltSi448 [csr-1p::GFP::csr-1(re-encoded; GFP inserted after aa #5 of isoform b) + Cbr-unc-119(+)] II. ItIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. The csr-1 coding sequence in the transgene was re-encoded for RNAi-resistance (see Gerson-Gurwitz A, et al. Cell. 2016, Supplementary Figure S3A). [NOTE: it is not known if unc-119(ed3) is still present in the background of this strain.] Reference: Gerson-Gurwitz A, et al. Cell. 2016 Apr 7;165(2):396-409.

ltSi539 [dlg-1p(delta)7::mCherry::his-72::unc-54 3’UTR + cnd-1p::mCherry::his-72::unc-54 3’UTR + Cbr-unc-119(+)] II. ltSi507 [hlh-1p::GFP::his-72::tbb-2 3’UTR + hlh-1p::mCherry::his-72::tbb-2 3’UTR +Cbr-unc-119(+)] IV. stIs10389 [pha-4::TGF(3E3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. During embryogenesis, ectoderm fluoresces red, mesoderm fluoresces yellow, and endoderm/pharynx fluoresces green. Reference: Wang S, et al. Development. 2019 Apr 11;146(7):dev174029. doi: 10.1242/dev.174029. PMID: 30890570.

CRISPR/Cas9 engineered deletion of mdf-2 in which the mdf-2 coding sequence was replaced by unc-119. Heterozygotes are wild-type GFP+ and segregate mdf-2 null homozygotes (low brood size/embryonic lethal), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Unknown if unc-119(ed3) from parental strain is still carried in the background. gRNA sequence: Gccaaattccccagttttag Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.

ltSi794 [dpy-7p::vhhGFP4::zif-1::unc-54 3'UTR + Cbr-unc-119(+)] II. Hypodermal-specific anti-GFP nanobody fused to ZIF-1 (Mediated by recruited ZIF-1 but NOT requiring ZF1 tags) mediates hypodermis-specific degradation of GFP-tagged proteins. Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine hypodermis-specific functions of target genes. Reference: Wang S, et al. Elife. 2015 Sep 15;4:e08649. Wang S, et al. http://biorxiv.org/content/early/2017/01/30/104398

ltSi953 [mec-18p::vhhGFP4::zif-1::operon-linker::mKate::tbb-2 3'UTR + Cbr-unc-119(+)] II. Touch response neuron (TRN)-specific expression of anti-GFP nanobody fused to ZIF-1 mediates TRN-specific degradation of GFP-tagged proteins (through recruited ZIF-1 but NOT requiring ZF1 tags). Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine TRN neuron-specific functions of target genes. Reference: Wang S, et al. http://biorxiv.org/content/early/2017/01/30/104398

CRISPR/Cas9 engineered deletion of cyb-3. Heterozygotes are wild-type GFP+ and segregate mdf-2 null homozygotes (embryonic lethal), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. gRNA sequences: tcaggtcgacattcttggcc & gttatgggtatgagagcatt Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.

mNeonGreen and Flag tags inserted at 3' end of endogenous cyb-1 locus using CRISPR/Cas9 engineering. gRNA sequence: atgcgtccacttttgcattc Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.

ltSi448 [csr-1p::GFP::csr-1(re-encoded; GFP inserted after aa #5 of isoform b) + Cbr-unc-119(+)] II. ItIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. The csr-1 coding sequence in the transgene was re-encoded for RNAi-resistance (see Gerson-Gurwitz A, et al. Cell. 2016, Supplementary Figure S3A). [NOTE: it is not known if unc-119(ed3) is still present in the background of this strain.] Derived from strain OD1764; transgene rescues csr-1, so the balancer is not needed to maintain transgenic strain. Reference: Gerson-Gurwitz A, et al. Cell. 2016 Apr 7;165(2):396-409.

ltSi240 [csr-1p::csr-1(re-encoded) + Cbr-unc-119(+)] II. The csr-1 coding sequence in the transgene was re-encoded for RNAi-resistance (see Gerson-Gurwitz A, et al. Cell. 2016, Supplementary Figure S3A). [NOTE: it is not known if unc-119(ed3) is still present in the background of this strain.] Derived from strain OD1463; transgene rescues csr-1, so the balancer is not needed to maintain transgenic strain. Reference: Gerson-Gurwitz A, et al. Cell. 2016 Apr 7;165(2):396-409.

ItSi98 [cpar-1p::GFP::cpar-1::cpar-1 3'UTR + Cbr-unc-119(+)] II. ItIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. mCherry-labeled histones. Reference: Gassmann R, et al. Nature. 2012 Apr 8; 484(7395): 534–537. doi: 10.1038/nature10973. PMID: 22495302.

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. meIs1 [pie-1p::GFP::lacI]. Made by crossing AV221 with OD56. Reference: Yuen KW, et al. Curr Biol. 2011 Nov 8;21(21):1800-7.

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. his-58 genomic sequence is inserted at Spe I site. Robust expression of transgene in early embryos and germ line; some expression in somatic cells also detectable. Maintain under normal conditions. Reference: McNally et al., JCB (2006).

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. qaIs3507 [pie-1::GFP::lem-2 + unc-119(+)].

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)]. Superficially wild-type. Maintain under normal conditions. Reference: Essex A, et al. Mol Biol Cell. 2009 Feb;20(4):1252-67. doi: 10.1091/mbc.e08-10-1047. Epub 2008 Dec 24. PMID: 19109417

Defective in dye filling (FITC or DiO) of amphid and phasmid neurons. Chemotaxis defective. Throws males.

Dyf. Osm. Throws males. Reduced mating efficiency (ME 2-3). Deletion extends over 1610 bp in the intron between exons 3 and 4 and ending 30 bp after the STOP codon (cosmid F02D8 pb 25954-27563 are deleted). Complements dyf-4(m158).

No obvious phenotype.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. drEx468 [ogt-1p::ogt-1(cDNA)::ogt-1 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Over-expression of OGT-1 in presumptive null mutant ogt-1(dr20) background. gpdh-1p::GFP is induced during hypertonic stress. Constitutive col-12p::DsRed expression. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. drEx469 [dpy-7p::ogt-1(cDNA)::ogt-1 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Hypodermal expression of OGT-1 rescues presumptive null allele ogt-1(dr20). gpdh-1p::GFP is induced during hypertonic stress. Constitutive col-12p::DsRed expression. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. drEx470 [nhx-2p::ogt-1(cDNA)::ogt-1 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Intestinal expression of OGT-1 provides tissue-specific rescue in ogt-1(dr20) presumptive null background. gpdh-1p::GFP is not induced during hypertonic stress. Constitutive col-12p::DsRed expression. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. drEx471 [myo-3p::ogt-1(cDNA)::ogt-1 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Muscle-specific expression of OGT-1 provides tissue-specific rescue in ogt-1(dr20) presumptive null background. gpdh-1p::GFP is not induced during hypertonic stress. Constitutive col-12p::DsRed expression. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. drEx472 [rab-3p::ogt-1(cDNA)::ogt-1 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Neuronal expression of OGT-1 provides tissue-specific rescue in ogt-1(dr20) presumptive null background. gpdh-1p::GFP is not induced during hypertonic stress. Constitutive col-12p::DsRed expression. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

Endogenous ogt-1 locus tagged with C-terminal GFP. OGT-1::GFP is expressed ubiquitously in somatic tissues with a nuclear localization. The OGT::GFP allele is functional. Superficially wild-type. Sanger sequence confirmed. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. K957M mutation introduced into the endogenous ogt-1 locus using CRISPR/Cas9; Sanger sequence confirmed. The K957M mutation ablates the O-GlcNAcylation activity of OGT-1 as measured by the RL2 O-GlcNAc antibody. gpdh-1p::GFP reporter is induced in the hypodermis and intestines during hypertonic stress. col-12p::GFP is constitutively expressed in the hypodermis. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

K957M mutation introduced into the endogenous ogt-1 locus tagged with C-terminal GFP. The K957M mutation ablates the O-GlcNAcylation activity of OGT-1 as measured by the RL2 O-GlcNAc antibody. OGT-1(K957M)::GFP is expressed ubiquitously in somatic tissues with a nuclear localization. Sanger sequence confirmed. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. H612A mutation introduced into the endogenous ogt-1 locus using CRISPR/Cas9; Sanger sequence confirmed. The H612A mutation decreases, but does not completely ablate, the O-GlcNAcylation activity of OGT-1 as measured by the RL2 O-GlcNAc antibody. gpdh-1p::GFP reporter is induced in the hypodermis and intestines during hypertonic stress. col-12p::GFP is constitutively expressed in the hypodermis. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. H612A mutation introduced into the endogenous ogt-1 locus tagged with C-terminal GFP. OGT-1(H612A)::GFP is expressed ubiquitously in somatic tissues with a nuclear localization. The H612A mutation decreases, but does not completely ablate, the O-GlcNAcylation activity of OGT-1 as measured by the RL2 O-GlcNAc antibody. Sanger sequence confirmed. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. TPR domain deleted in the endogenous ogt-1 locus using CRISPR/Cas9; Sanger sequence confirmed. The TPR domain deletion (128 aa - 583 aa) ablates the O-GlcNAcylation activity of OGT-1 as measured by the RL2 O-GlcNAc antibody. Defective gpdh-1p::GFP induction in the hypodermis and intestine during hypertonic stress. Constitutive col-12p::DsRed expression. Impaired adaptation to hypertonic stress. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

TPR domain deleted in the endogenous ogt-1 locus tagged with C-terminal GFP. The TPR domain deletion spans 128 aa - 583 aa. OGT-1(delta-TPR)::GFP is expressed ubiquitously in somatic tissues with a nuclear localization. The TPR domain deletion ablates the O-GlcNAcylation activity of OGT-1 as measured by the RL2 O-GlcNAc antibody. Sanger sequence confirmed. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. gpdh-1p::GFP reporter is induced in the hypodermis and intestines during hypertonic stress. col-12p::dsRed is constitutively expressed in the hypodermis. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. ogt-1(dr20) was isolated in an ENU screen in parental strain OG119 for mutants with decreased induction of the gpdh-1p::GFP reporter during hypertonic stress. dr20 is a presumptive null allele [Q600STOP]. OG969 has decreased gpdh-1p::GFP induction during hypertonic stress and impaired adaptation to hypertonic stress. Constitutive col-12p::DsRed expression. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. ogt-1(dr20) was isolated in an ENU screen in parental strain OG119 for mutants with decreased induction of the gpdh-1p::GFP reporter during hypertonic stress. dr15 is a presumptive null allele [R267STOP]. OG971 has decreased gpdh-1p::GFP induction during hypertonic stress and impaired adaptation to hypertonic stress. Constitutive col-12p::DsRed expression. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

otIs221 [cat-1::GFP]. norEx41 [ceh-43(fosmid) + dat-1::mCherry]. Him. tm480 embryonic lethality is rescued by extrachromosomal array. Pick mCherry+ animals to maintain.

otIs225 [cat-4::GFP]. norEx41 [ceh-43 (fosmid) + dat-1::mCherry]. Him. tm480 embryonic lethality is rescued by extrachromosomal array. Pick mCherry+ animals to maintain.

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. otIs77 [ttx-3p::kal-1 + unc-122p::GFP] II. ruIs37 [myo-2p::GFP + unc-119(+)] III. jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. vsIs33 [dop-3::RFP] V. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Koppen M, et al. Nat Cell Biol. 2001 Nov;3(11):983-91.

otIs355 [rab-3p(prom1)::2xNLS::TagRFP] IV. Pan-neuronal nuclear RFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.

otEx4812 [unc-30p(2.6kb promoter)::unc-3(cDNA)::unc-54 3'UTR + myo-2::GFP]. juIs14 [acr-2p::GFP + lin-15(+)]. Maintain by picking myo-2::GFP(+) animals. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989.

ntIs1 [gcy-5p::GFP + lin-15(+)] V. otIs305 [hsp-16.2p::che-1::3xHA::BLRP + rol-6(su1006)]. otEx4445 [snb-1::NLS::RFP + pBX]. Rollers. Maintain by picking RFP+ Rollers. Maintain at 20C to maintain extrachromosomal array. Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8.

otIs447 [unc-3p::mCherry + pha-1(+)] IV. DA/DB/VA/VB motor neuron class-specific red fluorescent reporter. Reference: Kerk SY, et al. Neuron 2017 (in press).

evIs82b [unc-129::GFP + dpy-20(+)] IV. otEx5966 [bnc-1p::mChOpti + pha-1(+)]. Maintain at 25C to select for presence of otEx5966 array. VA/VB motor neuron class-specific red fluorescent reporter. Reference: Kerk SY, et al. Neuron 2017 (in press).

inx-6(ot804) was generated by the insertion of SL2::NLS::YFP::H2B into the endogenous inx-6 locus. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.

inx-6(ot805) was generated by the insertion of GFP into the endogenous inx-6 locus. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.

oyIs14 [sra-6::GFP + lin-15(+)] V. ot820 is an 8bp deletion 15bp from the start of the sax-7S start codon, resulting in a frameshift and sax-7S isoform-specific null allele.

inx-6(ot804) was generated by the insertion of SL2::NLS::YFP::H2B into the endogenous inx-6 locus. ot840 was created by targeted disruption of the conserved TAATTA in the tagged inx-6(ot804). Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.

evIs82b [unc-129::GFP + dpy-20(+)] IV. De-repression of ectopic effector genes in VA/VB class motor neurons. Reference: Kerk SY, et al. Neuron 2017 (in press).