| MT8793 |
C. elegans |
ced-5(n1812) IV; nuc-1(e1392) X. Show Description
n1812: dead cells persist, maternal rescue of embryonic.
|
|
| MT8841 |
C. elegans |
lin-54(n2231) IV. Show Description
synMuv class B.
|
|
| MT8998 |
C. elegans |
unc-24(e138) sqv-1(n2819) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Uncs, SqvUncs and dead eggs. n2819: mid-L4 vulva abnormal, sterile.
|
|
| MT8999 |
C. elegans |
unc-42(e270) sqv-4(n2827) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Hets are Unc (n754) and segregate Unc (n754), Unc(e270)Sqv and dead eggs. n2827: mid-L4 vulva abnormal, sterile.
|
|
| MT9352 |
C. elegans |
sqv-6(n2845) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Uncs, Steriles and dead eggs. n2845: mid-L4 vulva abnormal, sterile.
|
|
| MT9371 |
C. elegans |
nIs50 IV. Show Description
nIs50 [mec-7::ced-3a + rol-6(su1006)]. Rollers.
|
|
| MT947 |
C. elegans |
unc-31(n422) IV. Show Description
Temperature sensitive egg laying defective. Retains late stage eggs. Paralyzed Unc.
|
|
| MT9830 |
C. elegans |
unc-36(e251) III; dpy-20(e1282) IV; lin-15B&lin-15A(n765) X. Show Description
|
|
| MT9958 |
C. elegans |
ced-10(n3246) IV. Show Description
Unengulfed cell corpses.
|
|
| MU1255 |
C. elegans |
nhr-67(tm2217) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP tm2217 homozygotes (arrested L1 larvae). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
|
|
| MU1269 |
C. elegans |
nhr-67(pf88) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+. Pick GFP+ to maintain -- viable pf88 homozygotes (Pvl Egl) can overtake the balanced population. nT1[qIs51] is homozygous lethal. qIs51 is an insertion of ccEx9747 with markers: myo-2::GFP expressed in the pharynx throughout development, pes-10::GFP expressed in the embryo, and a gut promoter F22B7.9::GFP expressed in the intestine. Reference: Verghese E, et al. Dev Biol. 2011 Aug 15;356(2):516-28.
|
|
| MU1289 |
C. elegans |
nhr-67(pf88) IV. Show Description
Pvl. Egl. Poor mating.
|
|
| NA404 |
C. elegans |
him-8(e1489) qui-1(gb404) IV. Show Description
Quinine avoidance defective. In qui-1(gb404) a CAA to TAA transition at position 11215 of Y45F10B generates a stop codon in the fifth exon of Y45F10B.10. Putative null allele.
|
|
| NA43 |
C. elegans |
gus-1(b410gb173) I; him-8(e1489) IV. Show Description
Intragenic revertant restoring to almost WT level of b-glucuronidase activity. Throws males.
|
|
| NB105 |
C. elegans |
fcd-2(tm1298) IV. Show Description
Homozygotes are viable, but are hypersensitive to DNA crosslinks.
|
|
| NB327 |
C. elegans |
ints-6(tm1615) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested nT1 aneuploids, and non-GFP dic-1 homozygotes. dic-1(tm1615) homozygotes arrest at the L3 larval stage. ints-6 previously known as dic-1.
|
|
| NB514 |
C. elegans |
exo-1(tm1842) III; parg-2(ok980) IV. Show Description
Double mutant is less sensitive to ionizing radiation than the parg-2(ok980) single mutant, but as sensitive as the exo-1(tm1842) single mutant. Parental parg-2(ok980) strain outcrossed 6 times; parental exo-1(tm1842) strain outcrossed 4 times. Reference: Bae W, et al. Hypersensitivity to DNA double-strand breaks associated with PARG deficiency is suppressed by exo-1 and polq-1 mutations in Caenorhabditis elegans. The FEBS Journal, In press.
|
|
| NB515 |
C. elegans |
polq-1(tm2572) III; parg-2(ok980) IV. Show Description
Hypersensitivity to ionizing radiation due to the parg-2(ok980) mutation is rescued by the polq-1(tm2572) mutation. The double mutant is as sensitive as the wild-type to ionizing radiation. Parental parg-2(ok980) strain outcrossed 6 times; parental polq-1(tm2572) strain outcrossed 5 times. Reference: Bae W, et al. Hypersensitivity to DNA double-strand breaks associated with PARG deficiency is suppressed by exo-1 and polq-1 mutations in Caenorhabditis elegans. The FEBS Journal, In press.
|
|
| NC138 |
C. elegans |
dpy-20(e1282) IV; wdIs3 X. Show Description
wdIs3[del-1::GFP + dpy-20(+)]. del-1 is expressed in the VB motor neurons beginning the the L2 larval stage. By the end of L2, del-1::GFP is also visible in a few VA motor neurons at the anterior end of the nerve cord. Expression of del-1::GFP in the VAs progresses in a wave from anterior to posterior, with all VAs expressing del-1::GFP by the adult stage. Thus, del-1::GFP is not expressed in the VAs during the L2 period in which unc-4 functions in those cells to establish synaptic inputs but is expressed in the VAs after they have been wired into the ventral cord circuit. del-1::GFP is also expressed in five neurons (VB1, VB2, SABVR, SABVL, VA1) in the retrovesicular ganglion at the anterior end of the ventral nerve cord. During the mid-L2 larval stage, del-1::GFP expression in the ventral nerve cord is largely restricted to the VB class of motor neurons.
|
|
| NC168 |
C. elegans |
unc-4(e26) II; dpy-20 IV; wdEx60. Show Description
wdEx60 contains [acr-5::GFP + dpy-20(+)]. Maintain by picking non-Dpy.
|
|
| NC1730 |
C. elegans |
unc-5(e152) IV; wdIs52. Show Description
wdIs52 [F49H12.4::GFP + unc-119(+)]. PVD defects in primary branch guidance, number of secondary branches, and tertiary branches are longer than wild-type.
|
|
| NC190 |
C. elegans |
wdIs6 II; dpy-20(e1282) IV. Show Description
wdIs6 [del-1::GFP + dpy-20(+)]. Embryonic GFP expression in SABVR, SABVL, VBs in mid-L2, VAs in mid-L3.
|
|
| NC197 |
C. elegans |
wdIs4 II; dpy-20(e1282) IV. Show Description
wdIs4 [unc-4::GFP + dpy-20(+)] II. Slightly Unc. GFP expression mosaic, occasional DA axon guidance defects. Embryonic expression: I5, DA, SABS; L1: AVF, VA; Late L3: VC. Early L1: GFP bright in I5, SABs, DA8/9, dim in DA1.
|
|
| NC2020 |
C. elegans |
coq-2(ok1066) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); juIs14 IV; wdEx658. Show Description
juIs14 [(pSC205) acr-2p::GFP + lin-15(+)] IV. wdEx658 [unc-25p::mCherry::unc-54 3'UTR + unc-119(+)]. Pick mCherry+ to maintain wdEx658. Homozygous larval lethal coq-2 mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ced-9 homozygotes (maternal effect lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT with GFP+ pharynx and mCherry+, and check for correct segregation of progeny to maintain.
|
|
| NC2484 |
C. elegans |
wdIs5 III; dpy-20(e1282) IV. Show Description
wdIs5 [unc-4::GFP + dpy-20(+)] III. Reference: Lickteig KM, et al. J Neurosci. 2001 Mar 15;21(6):2001-14.
|
|
| NC300 |
C. elegans |
dpy-20(e1282) IV; wdIs5. Show Description
wdIs5 [unc-4p::~1.5 exons of the unc-4 gene::GFP + (pMH86) dpy-20(+)]. Slightly Unc. GFP expression mosaic, occasional DA axon guidance defects. Embryonic expression: I5, DA, SABs; L1: AVF, VA; late L3: VC.
|
|
| NC3296 |
C. elegans |
ynIs37 III; juIs223 IV. Show Description
ynIs37 [flp-13::GFP] III. juIs223 [ttr-39p::mCherry + ttx-3p::GFP] IV. ttr-39::mCherry alone marks VD and DD neurons. ttx-3::GFP marks AIY neurons. Combined ttr-39::mCherry and flp-13::GFP co-expression marks DD neurons in the L2 (only a few mCherry+/GFP+ DD neurons will show up briefly in the L2 stage and gene silencing apparently dims the GFP marker over time). VD neurons can be identified by mCherry alone, no GFP. Derived by crossing parental strains CZ8332 and NY2037. Can be used to isolate VB neurons by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
|
|
| NC3524 |
C. elegans |
ufIs26 II; vsIs13 IV. Show Description
ufIs26 [unc-4p::mCherry + lin-15(+)] II. vsIs13 [lin-11::pes-10::GFP + lin-15(+)] IV. GFP expression in six VC neurons and posterior intestine. VC neurons are labeled with both GFP and mCherry; co-labeling in VCs1-5 is brightest during L4 stage. Derived by crossing parental strains NC2957 and LX959. Can be used to isolate VC neurons by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
|
|
| NC4085 |
C. elegans |
otIs355 IV; otIs846. Show Description
otIs355 [rab-3p(prom1)::2xNLS::TagRFP] IV. otIs846 [egas-1p::GFP + unc-122p::GFP]. Pan-neuronal nuclear RFP expression. Co-expression of GFP and RFP in IL2 neuron can be used to isolate IL2 by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
|
|
| NC571 |
C. elegans |
dpy-20 (e1282) IV; wdIs20. Show Description
wdIs20 [unc-4p::snb-1::GFP + dpy-20(+)]. Animals are Lon, likely due to dpy-20(+) overexpression. Punctate GFP expression observed in dorsal nerve cord, ventral nerve cord, VC4, and VC5. Reference: Lickteig KM, et al. J Neurosci. 2001 Mar 15;21(6):2001-14.
|
|
| NF4629 |
C. elegans |
vha-7(tk181) IV. Show Description
Short lifespan. vha-7(tk181) is a point mutation isolated as a suppressor of sqv-5(k175). tk181 represses the formation of tubular lysosome. Reference: Shibata Y, et al. Scientific Reports. In press.
|
|
| NF773 |
C. elegans |
fbl-1(k201) IV. Show Description
Isolated as a dominant suppressor of DTC migration defects of mig-17(k174). The fbl-1(k201) single mutant has weak DTC migration defects.
|
|
| NF774 |
C. elegans |
fbl-1(k206) IV. Show Description
Isolated as a dominant suppressor of DTC migration defects of mig-17(k174). The fbl-1(k206) single mutant has weak DTC migration defects.
|
|
| NF963 |
C. elegans |
fbl-1(tk45) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+. nT1[qIs51] is probably homozygous lethal. qIs51 is an insertion of ccEx9747 with markers: myo-2::GFP expressed in the pharynx throughout development, pes-10::GFP expressed in the embryo, and a gut promoter F22B7.9::GFP expressed in the intestine. fbl-1(tk45) homozygotes are Dpy, Sterile and are Distal Tip migration defective.
|
|
| NFB1722 |
C. elegans |
lag-1(vlc30[lag-1::T2A::mNG]) IV. Show Description
mNeonGreen tag inserted into endogenous lag-1 locus. Upstream flanking sequence: CCTACAAATCATTGGAACGACATGGACCGTGCAGAATTGTGTCCAATTAC. Downstream flanking sequence: TAGATTGGTCTCTCGCGGGATTACTGTATCTTTATATTGTCTCCTAATTT. Guide sequence: ATTACTAGATTCCACTCTCG. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
| NFB2468 |
C. elegans |
zdIs13 IV; vlcEx1288. Show Description
zdIs13 [tph-1p::GFP] IV. vlcEx1288 [hsp16.2p::lag-1A(cDNA) + ttx-3::mCherry + rol-6(su1006)]. Pick Rollers to maintain. Heatshock induces expression of LAG-1A. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
| NFB2471 |
C. elegans |
zdIs13 IV; vlcEx1290. Show Description
zdIs13 [tph-1p::GFP] IV. vlcEx1288 [hsp16.2p::lag-1D(cDNA) + ttx-3::mCherry + rol-6(su1006)]. Pick Rollers to maintain. Heatshock induces expression of LAG-1D. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
| NFB2518 |
C. elegans |
dat-1(syb4741[dat-1::T2A::NeonGreen]) III; him-8(e1489) IV. Show Description
NeonGreen tag inserted into endogenous dat-1 locus by CRISPR/Cas9 engineering. NeonGreen expression in dopaminergic neurons. Superficially wild type. Reference: Jimeno-Martín A, et al. Genome Res. 2022 Mar;32(3):459-473. PMID: 35074859.
|
|
| NFB2682 |
C. elegans |
him-8(e1489) IV; osm-5(syb6528[osm-5::SL2::GFP::H2B]) X. Show Description
SL2::GFP::H2B tag inserted at the C-terminus of the endogenous osm-5 locus by CRISPR. GFP expression labels ciliated sensory neurons. Him. Reference: Brocal-Ruiz R, et al. Elife. 2023 Jul 14;12:e89702. doi: 10.7554/eLife.89702. PMID: 37449480.
|
|
| NFB509 |
C. elegans |
zdIs13 IV; vlcEx284. Show Description
zdIs13 [tph-1p::GFP] IV. vlcEx284 [hsp-16.2p::hlh-3 + ttx-3::mCherry + rol-6(su1006)]. Rollers. Extrachromosomal array containing the heat shock responsive hsp-16.2 promoter for time controlled expression of hlh-3 transcription factor cDNA. Transcriptional tph-1 GFP reporter labels the serotonergic system. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
|
|
| NG2501 |
C. elegans |
epi-1(gm121) kyIs5 IV. Show Description
kyIs5 [ceh-23p::unc-76::GFP + lin-15(+)] IV. kyIs5 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons.
|
|
| NG324 |
C. elegans |
wsp-1(gm324) IV. Show Description
Low penetrance (about 25%) embryonic lethality and reduced brood size. wsp-1(gm324) is an N-terminal deletion that exhibits no observable mRNA or protein.
|
|
| NG4370 |
C. elegans |
zdIs5 I; pig-1(gm344) IV. Show Description
zdIs5 [mec-4p::GFP + lin-15(+)] I.
|
|
| NG57 |
C. elegans |
epi-1(gm57) IV. Show Description
Unc. Small Broods. Wit.
|
|
| NH2267 |
C. elegans |
let-60(n1046) IV; egl-15(n1454) X. Show Description
Unc and scrawny, but viable. Egl. Class II egl-15 mutation. Lethality suppressed by let-60.
|
|
| NH2447 |
C. elegans |
ayIs2 IV. Show Description
ayIs2 [egl-15p::GFP + dpy-20(+)] IV. GFP expression in vm1 sex muscles and other miscellaneous cells.
|
|
| NH2466 |
C. elegans |
ayIs4 I; dpy-20(e1282) IV. Show Description
ayIs4 [egl-17p::GFP + dpy-20(+)] IV.
|
|
| NH2531 |
C. elegans |
let-60(ay75)/dpy-20(e1362) IV. Show Description
ay75gf: ts dominant Clr, Sterile; Dominant sterile at 25C, fertile at 15C, severely reduced fertility at 20C. At 15C, ay75gf: recessive adults Clr, partially penetrant Muv. At 15C, heterozygotes segregate 50% WT, 25% Dpy, and 25% adult Clear.
|
|
| NIC203 |
C. tropicalis |
Caenorhabditis tropicalis wild isolate. Show Description
Caenorhabditis tropicalis wild isolate. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| NJ731 |
C. elegans |
exc-5(rh232) IV. Show Description
Formation of large round cysts in the excretory canal. The cysts begin to form shortly before hatching and is penetrant. The cysts grow in size throughout larval and adult stages, and can be lethal. The cysts form primarily at the canal tips. Some of the larger cysts may be visible by low power microscopy. Slight variable defects in the tail whip. Impenetrant distal tip cell migration defects (Mig).
|
|