| NL1947 |
C. elegans |
acy-1(pk907) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.
|
|
| NL2003 |
C. elegans |
ric-19(pk690) I. Show Description
pk690 is a deletion allele within the gene C32E8.7. The deletion is stable in the homozygous state and has no obvious phenotype. Can verify the presence/homozygosity of the deletion by PCR using the following primers: AL1: 5'-CGACGACACTCCATTATTCC-3' AR1: 5'-CCAGTCCTGCAAAAATGCTC-3'. A product of about 3.7 kb is obtained from WT worms, while a product of about 1 kb is obtained from NL2003 worms. The deletion has been sequenced and covers position -354 to +2276.
|
|
| NL2099 |
C. elegans |
rrf-3(pk1426) II. Show Description
Homozygous rrf-3 deletion allele. Increased sensitivity to RNAi when compared to WT animals. Deletion sequence (deletion in lower case letters, flanking undeleted sequence in capital letters): TGCACATATTctacagaatt ------- --------tacccgattaAATGGACAATT (from Plasterk Lab 11/05).
|
|
| NL2331 |
C. elegans |
gpa-16(pk481)/bli-3(e767) I. Show Description
Heterozygotes are WT and segregate WT, blistered, and lethals. pk481 previously called spn-1.
|
|
| NL3231 |
C. elegans |
acy-1(pk484) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.
|
|
| NL545 |
C. elegans |
dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Heat-shock conditions are 2 hours at 33C, which results in degeneration of neurons.
|
|
| NL585 |
C. elegans |
acy-1(pk301) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. acy-1 previously called sgs-1.
|
|
| NL587 |
C. elegans |
acy-1(pk311) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. acy-1 previously called sgs-1.
|
|
| NL597 |
C. elegans |
acy-1(pk384) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.
|
|
| NL705 |
C. elegans |
glc-2(pk55); mut-2(r459) I. Show Description
glc-2(pk55) previously called avm-2(pk55).
|
|
| NL724 |
C. elegans |
old-1(pk69) III. Show Description
C08H9.5 Previously called tkr-1.
|
|
| NL737 |
C. elegans |
mut-2(r459) I; mek-1(pk97) X. Show Description
K08A8.1 Previously called kin-17(pk97).
|
|
| NL788 |
C. elegans |
gpa-14(pk347) I. Show Description
[NOTE: (07/16/2015) The correct genotype of this strain is gpa-14(pk347) I. not gpa-14(pk342) as previously reported.]
|
|
| NLS1 |
C. elegans |
cdc-7(knu709) I. Show Description
CRISPR-engineered deletion removing entire cdc-7 gene. Out-crossed 3x to N2. Reference: Currey HN & Liachko NF. 2019. A CRISPR/Cas9-generated cdc-7 loss of function mutation does not cause temperature-dependent fertility defects. microPublication Biology. Jan 3;2019:10.17912.
|
|
| NM1448 |
C. elegans |
jsIs37 rpm-1(js410) V. Show Description
jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. Superficially wild-type. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope. Reduced SNB-1::GFP localization to synaptic regions; slighty Dpy. js410 has linked phenotype of reduced brood size. js410 is an R->Stop at aa 235. snb-1::GFP is expressed in mechanosensory neurons visible in the cell body and in the axon (very low levels). GFP puncta absent from the ventral nerve cord due to rpm-1 lesion.
|
|
| NM1455 |
C. elegans |
jsIs37 rpm-1(js317) V. Show Description
jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. Superficially wild-type. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope. Reduced SNB-1::GFP localization to synaptic regions; slighty Dpy. js317 is a W->Stop at aa 861. snb-1::GFP is expressed in mechanosensory neurons visible in the cell body and in the axon (very low levels). GFP puncta absent from the ventral nerve cord due to rpm-1 lesion.
|
|
| NM1568 |
C. elegans |
ehs-1(ok146) II. Show Description
An approx. 1-8 kb deletion in the ZK1248.3 gene which encodes a C. elegans homolog of the Eps15 (vertebrate) and pan1 (S. cervesisiae) gene. No obvious behavioral or morphological phenotypes.
|
|
| NM1581 |
C. elegans |
rpy-1(ok145) II. Show Description
Viable, fertile, with no obvious behavioral or morphological phenotypes. A 1677 bp deletion in the C18H9.7 gene which encodes a C. elegans homolog of the rapysn (vertebrate) gene. The lesion deletes exons 4 through 10, leaving exons 3 and 11 in frame. The deletion junction is cagaagaaaaagttcgctttgaactaaAGAACCTATTGAAAATTCTTACTT. Previously called rap-1.
|
|
| NM2040 |
C. elegans |
dhc-1(js121) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); jsIs37 V. Show Description
jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope. Heterozygotes are GFP+ in the pharynx. dhc-1 homozygotes are GFP- and sterile or partially sterile pvuls. Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP js121 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
|
|
| NM306 |
C. elegans |
jsIs1. Show Description
jsIs1 [(pSB120) snb-1::GFP + rol-6(su1006)]. Rollers. GFP expressed in the nerve ring, ventral cord and dorsal cord. Received new stock 3/10/2008 from Mike Nonet. Faint signal using a dissecting microscope. Obvious signal using a compound microscope (40X oil).
|
|
| NM4337 |
C. elegans |
rep-1(ok3296)/sC1(s2023) [dpy-1(s2170)] III. Show Description
rep-1(ok3296) homozygotes arrest as uncoordinated non-pumping starved L2/L3 animals. sC1(s2023) dpy-1 homozygotes are viable dpy animals. Heterozygotes are wild-type. Pick wild-type and check for correct segregation of progeny to maintain. ok3296 deletes 556 bp including the first 54 bp of exon 6 and has the sequence junction AGCTGAAACCGGTGCTACAG/CCATTCCTCTTCCCACTCTA. This strain replaces RB2411, which was an unbalanced heterozygous strain; also see NM4431. Reference: Dour S and Nonet ML. In preparation.
|
|
| NM4431 |
C. elegans |
rep-1(ok3296) jsIs682/sC1 [s2303) [dpy-1(s2170)] jsIs682 III. Show Description
jsIs682 [rab-3p::GFP::rab-3 + lin-15(+)] III. rep-1(ok3296) homozygotes arrest as uncoordinated non-pumping starved L2/L3 animals with GFP::RAB-3 mislocalized to neuronal cell bodies. Presence of jsIs682 makes definitive identification of ok3296 homozygotes much easier. sC1(s2023) dpy-1 homozygotes are viable dpy animals. Heterozygotes are wild-type. Pick wild-type and check for correct segregation of progeny to maintain. ok3296 deletes 556 bp including the first 54 bp of exon 6 and has the sequence junction AGCTGAAACCGGTGCTACAG/CCATTCCTCTTCCCACTCTA. This strain replaces RB2411, which was an unbalanced heterozygous strain; also see NM4337. Reference: Dour S and Nonet ML. In preparation.
|
|
| NM5209 |
C. elegans |
jsTi1453 jsSi1514 I; him-8(e1489) IV. Show Description
jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1514 [LoxP::RMCE mec-4p::GFP-C1::FRT3] I. RMCE insertion of mec-4 promoter driving GFP-C1. Reference: Nonet ML. Genetics. 2020.
|
|
| NOB142 |
C. elegans |
daf-2(e1370) III; isp-1(qm150) IV/nT1[qIs51] (IV;V). Show Description
Maintain at 15-20C: will form dauers at higher temps. Slow growing. Pick GFP+ to maintain. Heterozygotes are GFP+ and segregate WT GFP+ hets, arrested nT1[qIs51] aneuploids, and non-GFP daf-2(e1370); isp-1(qm150) homozygotes (sterile). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. [NOTE: Originally published daf-2(e1370); isp-1(qm150) strain MQ876 was found to not actually contain the daf-2(e1370) mutation. This strain was made to study the double mutant and revealed that daf-2(e1370); isp-1(qm150) homozygotes are inviable/sterile.] Reference: Cooper et al. In preparation.
|
|
| NS2937 |
C. elegans |
trf-1(nr2014) III. Show Description
No obvious phenotype.
|
|
| NS3026 |
C. elegans |
ikb-1(nr2027) I. Show Description
No obvious phenotype.
|
|
| NU3 |
C. elegans |
dbl-1(nk3) V. Show Description
Previously called cet-1(kk3). Short, somewhat Dpy. Males have crumpled spicules and abnormal rays; Similar to sma-2, sma-3, sma-4, sma-6 and daf-4.
|
|
| NW1229 |
C. elegans |
dpy-20(e1362) IV; evIs111. Show Description
evIs111 [F25B3.3::GFP + dpy-20(+)]. Pan-neural expression.
|
|
| NW1613 |
C. elegans |
msh-2(ev679::Tc1) I. Show Description
Reduced fertility. Reduced long-term survival. Mutator phenotype. DNA damage-induced apoptosis in the germ line. No effect on lifespan or meiotic chromosome disjunction observed.
|
|
| NW1692 |
C. elegans |
him-5 V; evIs190. Show Description
evIs190 [vab-1p::Venus + rol-6(su1006)]. Rollers. Reference: Ikegami et al. Curr Biol. 2012 Jan 10;22(1):1-11.
|
|
| NW1696 |
C. elegans |
him-5(e1490) V; evIs138. Show Description
evIs138 [plx-2(+) + sur-5::GFP]. Enhances sensory ray fusion defect of mab-20(bx61). No fusions as single.
|
|
| NW411 |
C. elegans |
enu-1(ev419) II; vab-8(ev411) V. Show Description
ev411 was previously called unc-107.
|
|
| NW427 |
C. elegans |
vab-8(ev411) V. Show Description
Slightly Unc. ev411 was previously called unc-107.
|
|
| NW906 |
C. elegans |
pag-1(ls2) III; dpy-20(e1282) IV; seu-2(ev523) evIs41 V. Show Description
evIs41[mec-7::lacZ; mec-7::unc-5; dpy-20(+)] V. Suppresses axon guidance phenotype ofmec-7::unc-5. Has slight Uncoordinated phenotype.
|
|
| NW988 |
C. elegans |
pag-1(ls2) III; dpy-20(e1282) IV; seu-3(ev555) evIs41 V. Show Description
evIs41[mec-7::lacZ; mec-7::unc-5 + dpy-20(+)] V. Suppresses axon guidance phenotype ofmec-7::unc-5. Has slight Uncoordinated phenotype.
|
|
| NWG316 |
C. elegans |
pkc-3(crk77[I331A,T394A]) II; par-2(it328[gfp::par-2]) III. Show Description
GFP tag inserted into endgonenous par-2 locus in an analogue-sensitive background. pkc-3(crk77[I331A,T394A]) is a CRISPR-engineered analog-sensitive allele containing both I331A (gatekeeper site) and T394A (suppressor site) mutations, allowing rapid and reversible chemical inhibition of PKC-3 activity. Reference: Ng K, et al. (2022). An analog sensitive allele permits rapid and reversible chemical inhibition of PKC-3 activity in C. elegans. Reference: Ng K, et al. microPublication Biology. 10.17912/micropub.biology.000610
|
|
| OC199 |
C. elegans |
zyg-1(it25) sds-22(bs9) II. Show Description
it24 is temperature sensitive; produces maternal effect embryonic lethal phenotype (Mel) after shift to 24C at L4 stage. Mel is partially suppressed by bs9 at 24C. sds-22 previously called szy-6. Reference: Kemp C, et al. (2007) Genetics 176:95-113.
|
|
| OC235 |
C. elegans |
sun-1(bs12) unc-76(e911) V. Show Description
Unc. bs12 mutation causes sublethal defect in attachment of centrosome to the nucleus in early embryos. Viable 15-25 C. Reference: Kemp et al. (2007) Genetics 176:95-113.
|
|
| OC271 |
C. elegans |
pph-4.1(tm1598) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm1598 homozygotes (produce ~100% dead eggs, slightly higher penetrance at 25C). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Peters N, et al., J Cell Sci. 2010 Mar 1;123(Pt 5):795-805.
|
|
| OC306 |
C. elegans |
ttll-4(tm3310) III. Show Description
Phenotypically wild-type for brood size, viability, Dyf and male mating efficiency. Strain OC306 is identical to OC422: the same out-crossed stock was frozen down twice in lab stocks. Reference: Chawla DG, et al. Biol Open. 2016 Sep 15;5(9):1290-8. doi: 10.1242/bio.017442. PMID: 27635036
|
|
| OC343 |
C. elegans |
ttll-5(tm3360) V. Show Description
Phenotypically wild-type for brood size, viability, Dyf and male mating efficiency. Reference: Chawla DG, et al. Biol Open. 2016 Sep 15;5(9):1290-8. doi: 10.1242/bio.017442. PMID: 27635036
|
|
| OC419 |
C. elegans |
ttll-9(tm3889) V. Show Description
Phenotypically wild-type for brood size, viability, Dyf and male mating efficiency. Reference: Chawla DG, et al. Biol Open. 2016 Sep 15;5(9):1290-8. doi: 10.1242/bio.017442. PMID: 27635036
|
|
| OC423 |
C. elegans |
ttll-11(tm4059) IV. Show Description
Phenotypically wild-type for brood size, viability, Dyf and male mating efficiency. Reference: Chawla DG, et al. Biol Open. 2016 Sep 15;5(9):1290-8. doi: 10.1242/bio.017442. PMID: 27635036
|
|
| OCF12 |
C. elegans |
lpin-1(ok2761) V/nT1 [qIs51] (IV;V). Show Description
Heterzygotes are wildtype and GFP+. lpin-1(ok2761) homozygotes die as L1 larvae. Homozygous nT1[qIs51] inviable.
|
|
| OD2773 |
C. elegans |
ltSi915 II; unc-119(ed3) III. Show Description
ltSi915 [osm-6p::zif-1::operon-linker::mCherry::histone::tbb-2 3'UTR + Cbr-unc-119(+)] II. This strain provides a sensory neuron-specific source of ZIF-1 alone and serves as a control strain for OD2772, which mediates ciliated sensory neuron-specific degradation of GFP-tagged proteins. It can also be used as source of sensory-specific ZIF-1 for other applications. Superficially wild type. Reference: Wang S, et al. Development. 2017 Jun 15. pii: dev.150094. doi: 10.1242/dev.150094.
|
|
| OD3696 |
C. elegans |
plk-1(lt106[plk-1 C52V] lt108[plk-1 L115G]) III. Show Description
Analog-sensitive allele generated by CRISPR/Cas9 engineering of the endogenous plk-1 locus. Engineered mutations confer sensitivity to 1-NM-PP1 for drug inhibition of plk-1. gRNA sequences: GGACGATTTTTGGGCAAGGG & TCTCAACGTGTATATCACTT Reference: Gomez-Cavazos JS, et al. Curr Biol. 2020 Aug 17;30(16):3101-3115.e11. doi: 10.1016/j.cub.2020.05.090 PMID: 32619481.
|
|
| OD63 |
C. elegans |
unc-119(ed3) III; ltIs43/+. Show Description
ltIs43[pAA26; pie-1::GFP-TEV-STag::ZEN-4; unc-119(+)]. Insertion only viable when heterozygous. Pick non-Unc worms to maintain.
|
|
| OE3003 |
C. elegans |
xbx-4(ok635) IV. Show Description
No obvious phenotype.
|
|
| OE3005 |
C. elegans |
xbx-6(ok852) V. Show Description
No obvious phenotype.
|
|
| OG1120 |
C. elegans |
ogt-1(dr20) III; drIs4 IV; drEx470. Show Description
drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. drEx470 [nhx-2p::ogt-1(cDNA)::ogt-1 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Intestinal expression of OGT-1 provides tissue-specific rescue in ogt-1(dr20) presumptive null background. gpdh-1p::GFP is not induced during hypertonic stress. Constitutive col-12p::DsRed expression. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.
|
|