Caenorhabditis Genetics Center (CGC)

More Fields
Strain Species Genotype
NL788 C. elegans gpa-14(pk347) I. Show Description
[NOTE: (07/16/2015) The correct genotype of this strain is gpa-14(pk347) I. not gpa-14(pk342) as previously reported.]
VC4088 C. elegans gpa-14(gk5176) I. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5176 mutation is T->A, flanking sequences ACCTCTGGATCCAATTGAACATATTACATA and GAAATTGATGAAATCTATGCTCCAATGTCT.
NL1610 C. elegans dpy-20(e1282) IV; pkIs590. Show Description
pkIs590 [gpa-14::GFP + dpy-20(+)]. GFP+.
NL1593 C. elegans dpy-20(e1282) IV; pkIs552. Show Description
pkIs552[gpa-14XS(+) dpy-20(+)]. Not know to which LG the insertion is attached.