Search Strains

wdEx595 [F08G12.1::GFP + unc-119(+)]. Pick non-Unc to maintain. Construct made by Marc Vidal's group at Harvard as part of the promoterome project.

2 kb deletion mutant made by OMRF Knockout Group. Presumptive null. No obvious phenotype. Primers used: EL1: GAAACGGTGAGTGCCAATTT. ER1: AGTGCTGTCACACCAAGCAC. IL1: AAACCAACTGACCCAAGGTG. IR1: TATCTAGGGTCCGCACAACC. Left breakpoint sequence: AGGTTGACAAATTGTTGCGA. Right breakpoint sequence: CGCTTATTAAAAAATAATAT.

No obvious phenotype. 1.5 kb deletion of acr-5 produced by Moulder/Barstead at OMRF. Left breakpoint sequence: TGGGTGATGCTATATGCACA. Right breakpoint sequence: TAGACTTCCGAGCAATAATTC.

No obvious phenotype. 2 kb deletion of acr-5 produced by Moulder/Barstead at OMRF. Deletion removes all 4 transmembrane domains. This is likely a null allele. Left breakpoint sequence (includes repeated sequence): TTTTTAATTATCCGTAATTTTTTAATTATCCGTAAT. Right breakpoint sequence: AACATCTTTAATCGATTTAT.

No obvious phenotype. 2.4 kb deletion of acr-5 produced by Moulder/Barstead at OMRF.

wdEx290 [acr-15::GFP + unc-119(+)]. Pick non-Unc to maintain. GFP expression in VNC, head neurons, and tail neurons. Construct made by M. Vidal lab; candidate unc-37 target gene.

wdEx329 [F09C3.2::GFP + unc-119(+)]. Pick non-Unc to maintain. GFP expression in ventral nerve cord. Construct made by M. Vidal lab; candidate unc-37 target gene.

wdEx345 [F55C12.4::GFP + unc-119(+)]. Pick non-Unc to maintain. GFP expression in VNC, head neurons, and tail neurons. Construct made by M. Vidal lab; candidate unc-37 target gene.

wdEx346 [tig-1::GFP + unc-119(+)]. Pick non-Unc to maintain. GFP expression in head neurons, tail neurons. head muscles, and vulva. Construct made by M. Vidal lab; candidate unc-37 target gene.

wdEx348 [C13G3.1::GFP + unc-119(+)]. Pick non-Unc to maintain. GFP expression in VNC, head neurons, and tail neurons. Construct made by M. Vidal lab; candidate unc-37 target gene.

wdEx351 [tsp-7::GFP + unc-119(+)]. Pick non-Unc to maintain. GFP expression in motor neurons. Construct made by M. Vidal lab; candidate unc-37 target gene.

wdEx353 [Y34D9B.1a::GFP + unc-119(+)]. mig-1::GFP construct made by Marc Vidal's group at Harvard as part of the promoterome project; unc-37 target gene. GFP expression observed in all classes of VNC motor neurons, head & tail neurons, body wall muscle, and intestine. [The strain is described as unc-119 and unc-119(+) as the co-injection marker, but looks to actually be lin-15 (Muv).]

wdEx381 [F55C12.4::GFP + unc-119(+)]. Pick non-Unc to maintain. GFP expression in VNC, head neurons, and tail neurons. Construct made by M. Vidal lab; candidate unc-37 target gene.

mig-22(tk69): DTC migration defect and maternal effect embryonic lethal. Heterozygotes are WT with pharyngeal GFP signal. Homozygous hT2[bli-4 let-? qIs48] are inviable.

Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tk158 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Shibata Y, et al. Biol Open. 2019 Jan 17;8(1):bio038448. doi: 10.1242/bio.038448. PMID: 30635266.

Animals with sDp2 are WT. Animals without the duplication are severe Uncs with withered tails, are small and often have lateral ectopic vulvae. gm123 does not survive through more than 1-2 generations. Many cell migrations defects in gm123 animals.

Heterozgyotes are WT and segregate WT, Dpys and Uncs. Recombination occurs in this strain so pick individual WT animals and score the progeny for both Dpys and Uncs.

Unc. Some Clr larvae. Homozygous semi-viable.

Unc and scrawny, but viable. Egl. Class II egl-15 mutation. Lethality suppressed by let-60.

No obvious phenotype. The primers used to isolate (ok198)were: LS969.E1: TGAGCTCGGAGATGTTGCT; LS969.E2: CCGGTCATTCCTCATTCACT; LS969.I1: GGGAGGGTCTTACGTTGTGA; LS969.I2: GTCGAAAAATCAACTTGCGG; The deletion band runs at about 2000bp. The wt band (based on the inside primers) is 3195bp making the deletion about 1200bp of the gene F54A5.3.

Do not keep below 20°C.  Male-female.  Caenorhabditis sp. 39 wild isolate. Gonochoristic species; isofemale line. Isolated from rotting Clusia fruits on the island of Dominica (2014). Previously known as Caenorhabditis sp. 39.

Unreflexed gonad. Previously known as mig-8.

Poorly growing strain; most homozygotes fail to reach adulthood, and those that do are Egl. smg suppressable and tends to accumulate second site mutations that suppress the Mua phenotype and restore vigorous growth.

Formation of large round cysts in the excretory canal. The cysts begin to form shortly before hatching and is penetrant. The cysts grow in size throughout larval and adult stages, and can be lethal. The cysts form primarily at the cell body. Some of the larger cysts may be visible by low power microscopy. Slight variable defects in the tail whip. 100% penetrant.

Formation of large round cysts in the excretory canal. The cysts begin to form shortly before hatching and is penetrant. The cysts grow in size throughout larval and adult stages, and can be lethal. The cysts form primarily at the cell body. Some of the larger cysts may be visible by low power microscopy. Slight variable defects in the tail whip.

Excretory canal defect. Large fluid-filled cysts appear randomly along the excretory canal, especially at the tips: 100% penetrant. Cysts often visible as clear spots by low-power microscopy. Shortened canals. Smaller cysts in amphid sheath. Stop mutation in 2nd Ras-like IRGP domain. Encodes homologue of human IRGC. [NOTE (08/2025): The correct genotype of this strain is exc-1(rh26), not exc-3(rh26) as previously described.]

Mua, not viable. Cytokinesis is defective in both hypodermis and germline resulting in mutinucleate cells.

Excretory canal defect. Canals are shortened and animal is somewhat pale. Defect visible only by Nomarski microscopy. Tail spike is often malformed.

Heterozygotes are WT and segregate WT, Unc and Long Thin Steriles (that arrest before the adult stage). cul-1 animals have excess cell divisions in post-L1 blast cell lineages. cul-1 was formerly known as lin-19.

Homozygous viable, but poor growth and some mortality at lower osmolarity. Large fluid-filled cysts in excretory cell body and shortened canals, sometimes visible with dissecting microscope. Encodes intermediate filament protein. ifc-2 formerly known as exc-2. References: Buechner M, et al. Dev Biol. 1999 Oct 1;214(1):227-41. doi: 10.1006/dbio.1999.9398. PMID: 10491271.

Homozygous viable, but poor growth and some mortality at lower osmolarity. Large fluid-filled cysts in excretory cell body and shortened canals, sometimes visible with dissecting microscope. Encodes intermediate filament protein. ifc-2 formerly known as exc-2. References: Buechner M, et al. Dev Biol. 1999 Oct 1;214(1):227-41. doi: 10.1006/dbio.1999.9398. PMID: 10491271. Yang Z, et al. J Cell Biol. 2020 Nov 2;219(11):e202003152. doi: 10.1083/jcb.202003152. PMID: 32860501.

Excretory canal defect. Canal is invariably short with multiple cysts of varying size clustered along length, especially at the tips. Visible only by Nomarski microscopy. Tail spike is often slightly malformed. Animal is somewhat pale.

Formation of large round cysts in the excretory canal. The cysts begin to form shortly before hatching and is penetrant. The cysts grow in size throughout larval and adult stages, and can be lethal. The cysts form primarily at the canal tips. Some of the larger cysts may be visible by low power microscopy. Slight variable defects in the tail whip. Impenetrant distal tip cell migration defects (Mig).

Excretory canal defect. Hypomorphic allele. Canals are slightly shortened. Defect visible only by Nomarski microscopy.

Excretory canal defect. Canal varies in length from no outgrowth to almost complete outgrowth. Frequent small vacuoles and extra branchings in the canal lumen visible only by Nomarski microscopy. Animals are somewhat pale.

qyIs127 [lam-1p::lam-1::mCherry + unc-119(+)] V. qyIs166 [cdh-3p::GFP::CAAX + unc-119(+)] X. Temperature-sensitive sterile; maintain at 20C or lower for optimum fertility. Increased sensitivity to RNAi when compared to wild-type animals. lam-1p::lam-1::mCherry expression can be weak and variable. Reference: Kelley, LC, et al. Developmental Cell. 2019 Feb 11;48(3):313-328.e8.

qyIs366 [ser-2(prom3)::hpo-30::GFP + unc-119(+)] V. Reporter allows visualization of HPO-30 trans-membrane protein in PVD dendrites. Reference: Zou W, et al. PLoS Genet. 2015 Sep 22;11(9):e1005484. PMID: 26394140.

qyIs368 [ser-2(prom3)::dma-1::GFP + unc-119(+)] I. Reporter allows visualization of DMA-1 trans-membrane protein in PVD dendrites. Reference: Zou W, et al. PLoS Genet. 2015 Sep 22;11(9):e1005484. PMID: 26394140.

qySi148 [lin-29p::2xmKate2::PLCdeltaPH] I. mNeonGreen tag inserted into C-terminus of endogenous lam-2 locus. Superfically wild-type strain with AC-specific plasma membrane marker and BM marker. BM visualized with endogenously tagged laminin. Plasma membrane marker inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination.

Caenorhabditis inopinata wild isolate; 10x inbred line. Male-Female. Maintain by mating at 25C or above; does not grow well at 20C. See reference for the details d(https://www.nature.com/articles/s41467-018-05712-5). Sibling species of C. elegans. Inbred 10 times, full genome sequence available. Frozen stock recovery is lower efficiency than C. elegans with glycerol; DMSO method works more efficiently. Adult: Large and slender species; ca. 1.5–2.5?mm in length, and individuals may reach up 3.0?mm under optimal culturing conditions. Cuticle is moderate to thick with four-lined lateral field. Deirids on the lateral field, at the level slightly behind the secretory–excretory pore. Lip separated into six sectors, not clearly offset. Six labial sensilla and four cephalic sensilla present. The anterior end of each lip sector very slightly elongated and forming six stomatal flaps. Amphid small, oval pore-like, at the level of the margin of cheilo and gymnostom. Tube-like stoma separated into three parts; short tube-like cheilostom; simple tube-like gymnostom, which is weakly separated into two subsections; and tube-like stegostom covered by pharyngeal sleeve, which is separated into four subsections, prostegostom, mesostegostom, metastegostom, and telostegostom. Metastegostomatal three teeth flap-like. Pharynx separated into four sections; procorpus forming muscular tube, well-developed metacorpus (median bulb); glandular and narrow isthmus; and basal bulb with double haustrulum as the glottoid apparatus. Pharyngo-intestinal valve (cardia) prominent. Nerve ring around the middle of isthmus. Excretory pore located around the margin of isthmus and basal bulb. Female: Gonadal system didelphic, amphidelphic. Anterior and posterior gonadal system are basically symmetric with each other, arranged as ovary, oviduct, spermatheca, spermathecal-uterus junction tissue, uterus and vulva/vagina from distal. Sometimes more than 20 developing eggs are deposited. Tail conical or forming slightly elongated conus with pointed tip. Anus and rectum clearly visible; three (two subventral and one dorsal) rectal glands present. Phasmid forming small pore at ca. 60% of total tail length from anus. Male: Testis single, anteriorly reflexed rightwardly. Vas deferens occupying ca. 1/5 of total gonadal length. Tail enveloped by a closed bursa, supported by nine pairs of bursal rays. Anterior cloacal lip with a rounded and sclerotized appendage and bulge-like appendage between rounded appendage and cloacal opening; a small sensilla-like papilla on the bulge-like appendage. Posterior cloacal lip with tongue-like appendage with two cloacal sensilla. Spicules paired, separate, long and slender with evenly slightly ventrally curved blade and simply pointed tip. Gubernaculum slender, ventrally arcuate with small squared appendage at the distal end in lateral view. Bursa heart-shaped in ventral view, anteriorly closed with serrated edge; serratae obvious in anterior half and vague in posterior half; terminal notch present but unclear. The nine pairs of genital papillae or bursal rays supporting the bursal velum with an arranged (2/1?+?1?+?2?+?3).

Caenorhabditis sp 36 wild isolate. Male-female strain. Maintain by mating. Maintain at 25C. A gonochoristic species isolated from adult weevils (Niphades variegatus), with whom they appear to be tightly associated during its life cycle. A genome comparison highlighted that C. sp. 36 has the smallest genome so far sequenced in the elegans supergroup, despite of being closely related to the largest genome species, C. japonica.

2.6 kb deletion. pk87 homozygotes have a variable defect in hyp10 morphogenesis; most obvious in L1-L2 larvae. Rescued by WT copy of cdh-3 present on cosmid ZK112.

pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene.

Drug sensitive. No visible phenotype. pgp-1 and pgp-3 deletion alleles.

pgp-3 deletion allele. No visible phenotype. Drug sensitive (colchicine, chloroquine). Throws males: outcrossed with him-8(e1489) so probably contains this mutation.

pgp-1 deletion allele. No visible phenotype. Might be sensitive to drugs.

pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.

pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene.

pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.

pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene.