Search Strains

otEx1043 [dop-1(prom2)::GFP + pha-1(+)].

otIs937 [ceh-19(prom2)::daf-2(DN)::eBFP2::SL2::tagRFP-T::tbb-2 3' UTR + unc-122p::GFP::unc-54 3' UTR] V. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. ceh-19(prom2) drives expression of daf-2(DN) specifically in the MC neurons in the pharyngeal nervous system. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.

otIs942 [tph-1(prom5)::daf-2(DN)::eBFP2::SL2::tagRFP-T::tbb-2 3' UTR + unc-122p::GFP::unc-54 3' UTR] V. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. tph-1(prom5) drives expression of daf-2(DN) specifically in the NSM neurons. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.

SL2::mScarlet3::H2B tag inserted after STOP codon of endogenous Cbr-cat-1 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.

SL2::mScarlet3::H2B tag inserted after STOP codon of endogenous Ctr-cat-1 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.

otEx1000 [hsp16-2::exc-4(cDNA)::GFP + rol-6(su1006)]. Maintain by picking Rollers.

otIs3 [gcy-7::GFP + lin-15(+)]. Integrated from adEx1288; genetically mapped between 3.05 m.u. (T19B10) and 5.86 m.u. (AH10) on V. GFP expression appears in ASEL and the excretory cell in adult animals.

ntIs1 [gcy-5p::GFP + lin-15(+)] V. Ectopic expression of ntIs1 in ASEL. Rollers. Whole genome sequenced strain.

Heterozygotes are WT and segregates WT, DpyUncs and Mua. rh197 animals are inviable as homozygotes.

Weak recessive allele of mua-3. 40% have muscle detachment from cuticle in adults, primarily in head, results in weak bent head phenotype. 60% are wild type.

UV Hypersensitive. Eggs laid early in adulthood: 100% inviable. Eggs laid late in adulthood: 70% viable.

syIs188 [POPTOP + unc-119(+)]. Maintain by picking non-Uncs. syIs188 suppresses pry-1(mu38) Muv phenotype. Do not distribute this strain; other labs should request it from the CGC.

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C17H12.4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATTGGAAAATTAAGATTTCAAAAACCAGAACCGCCT Right flanking sequence: GAGAAATGGACCGGAGTGAGAAATGCAAAAGgtatg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ACTCCGGTCCATTTCTCAGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Heterozygotes are WT and segregate embryonic lethals (sy216 homozygotes) and paralyzed Uncs (h1040 homozygotes). sy216 is a deletion of the unc-101 gene region. Do not distribute this strain; other labs should request it from the CGC.

umnIs78 [myo-2p::mKate2 + NeoR, I: 12541645 (intergenic)] I. Heterozygous strain. Crossover suppressor for LGI right. Inversion includes unc-75 and unc-54(h1040). Heterozygotes are wild-type (not paralyzed) with dim mKate2 expression in pharynx, and segregate heterozygotes (not paralyzed, dim mKate2), homozygous wild-type (not paralyzed, no mKate2), and hIn1 homozygotes (paralyzed, bright mKate2). Pick non-paralyzed, dim mKate2 worms and check for correct segregation of progeny to maintain. Maintain at 20C or higher: recombined balancer seems more prone to breaking down at low temperatures. Derived by crossing parental strain CGC105 (hIn1[umnIs78]) to RG3173 (Y40B1B.7(ve673[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hIn1[unc-54(h1040)]) and selecting for the recombined hIn1 worms.

umnIs75 [myo-2p::GFP + NeoR, I: 12541645 (intergenic)] I. Heterozygous strain. Crossover suppressor for LGI right. Inversion includes unc-75 and unc-54(h1040). Heterozygotes are wild-type (not paralyzed) with dim GFP expression in pharynx, and segregate heterozygotes (not paralyzed, dim GFP), homozygous wild-type (not paralyzed, no GFP), and hIn1 homozygotes (paralyzed, bright GFP). Pick non-paralyzed, dim GFP worms and check for correct segregation of progeny to maintain. Maintain at 20C or higher: recombined balancer seems more prone to breaking down at low temperatures. Derived cross of parental strains CGC94 (hIn1[umnIs75]) to QP2460 (hIn1[umnIs78, unc-54(h1040)]/+) and selecting for the recombined hIn1 worms.

H13N06.6 Homozygous. Outer Left Sequence: aagcaggatcaggagcacat. Outer Right Sequence: atgagaagtgccgttgctct. Inner Left Sequence: catgtcattgatggctggac. Inner Right Sequence: gaacgccagttggttgattt. Inner Primer PCR Length: 2851. Estimated Deletion Size: about 850 bp. 12/2004: From Laura DiCaprio: The deletion is 981 base pairs from X: 15500754 - 15501734. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F38H12.3 Homozygous. Outer Left Sequence: tacaatcatggttccgggtt. Outer Right Sequence: tttgatgctcggtcattttg. Inner Left Sequence: cccaaccgactactctcgaa. Inner Right Sequence: ttgaacggatcgcttacaca. Inner Primer PCR Length: 2951. Estimated Deletion Size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C15H11.3 Heterozygotes are WT and GFP+. ok1281 animals arrest as larvae. Outer Left Sequence: gagcttctgcaggacacaca. Outer Right Sequence: ctgcgaagatgggaaaagag. Inner Left Sequence: tgaaaagctcagtgacggtg. Inner Right Sequence: ctcgtctgcatttttgcgta. Inner Primer PCR Length: 3153. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C10H11.9 Heterozygotes are WT and GFP+. Maintain by picking GFP+ worms. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: tcaatgaagcgtcgaagttg. Outer Right Sequence: gatcgagataatgcgggaga. Inner Left Sequence: cgagttcacgagagagaccc. Inner Right Sequence: gccgaagacatttaacggaa. Inner Primer PCR Length: 3323. Estimated Deletion Size: about 1800 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C17H12.9 Homozygous. Outer Left Sequence: agttcctctgccgcttgtaa. Outer Right Sequence: aagttcggggaatttcgtct. Inner Left Sequence: gcaaccacgtagcttcacaa. Inner Right Sequence: ttggaaatggaatcacccat. Inner Primer PCR Length: 3028. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C24H12.9 Homozygous. Outer Left Sequence: tcaattccttgtttttgggc. Outer Right Sequence: gtcttgctcgcctctttctg. Inner Left Sequence: gtgcctccaaattacgcact. Inner Right Sequence: atcatccgagatccatttgc. Inner Primer PCR Length: 2113. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H14N18.1 Homozygous. Outer Left Sequence: tgaaagcaaacgagacatcg. Outer Right Sequence: accaccacctgatctcttgc. Inner Left Sequence: ttttctgtctcacggagcct. Inner Right Sequence: ccagaaaagggacaaccgta. Inner Primer PCR Length: 2756. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F57H12.4 Homozygous. Outer Left Sequence: atttgccccctttgagactt. Outer Right Sequence: tgctttttccgaaattccat. Inner Left Sequence: tgccccctaagaacattgac. Inner Right Sequence: taacatgctgctggcatttc. Inner Primer PCR Length: 2957. Estimated Deletion Size: about 1300 bp. The breakpoint sequence from Neline Kriek is: atccatcaatgcatca - breakpoint - agcgcaatattcaag. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C32H11.10, C32H11.11. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y59H11AL.1 Homozygous. Outer Left Sequence: tggaacacttccccaaactc. Outer Right Sequence: tgatacgggaaaagctacgc. Inner Left Sequence: ggaagcagtttgctctccag. Inner Right Sequence: aattggcagagttgtttcgg. Inner Primer PCR Length: 3299. Estimated Deletion Size: about 2500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T01H10.8. Homozygous. Outer Left Sequence: ggttccgacgcaaataaaaa. Outer Right Sequence: tcacgcaatctcatccaaaa. Inner Left Sequence: aatctccacgttttggttgg. Inner Right Sequence: agcaccgtcgtagctcagtt. Inner Primer PCR Length: 3120. Deletion Size: 884. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H14A12.4, H14A12.6. Homozygous. Outer Left Sequence: ATCATCGCTGGTCTTGATCC. Outer Right Sequence: GAGTCTTTCGTTGCGAGACC. Inner Left Sequence: TCATTGAAAAGGAACCCTCG. Inner Right Sequence: TTTACCCTTCCCGTTGACAC. Inner Primer PCR Length: 2285 bp. Deletion Size: 1183 bp. Deletion left flank: ATAGTTGAAACATTTTTGACTGTAATTAAA. Deletion right flank: TGAATCGTGACTTTTCCGACAAACCGGGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F41H10.11 Dpy animals. Homozygous. Outer Left Sequence: ttcccgagattcagatgtcc. Outer Right Sequence: gttggtggacgaggaaaaag. Inner Left Sequence: acctggtggatcagaagctg. Inner Right Sequence: cgggtagaataaaccgacga. Inner Primer PCR Length: 2236. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F23H11.8. Homozygous. Outer Left Sequence: GTCGATTTCCGGTGTGTTTT. Outer Right Sequence: ACGTTGCTGAAATTTTTGGG. Inner Left Sequence: GAAACCGTGCTTTTCAAGGA. Inner Right Sequence: TTTGCCGGAAACTTCAATTC. Inner Primer PCR Length: 2991 bp. Deletion Size: 1552 bp. Deletion left flank: TGCCTACTATTAGCAATTGTGAAGAACCAA. Deletion right flank: AAAACAACGATATGCTACAAAAAATTTAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K02H11.6. Homozygous. Outer Left Sequence: TTGAAGAGAGAGCGAGAGCC. Outer Right Sequence: TTGACCCGTTTGCCAATTAT. Inner Left Sequence: ACTGGGGGAGCACAATATCA. Inner Right Sequence: CGCTCATTCTTCTTTCAGGG. Inner Primer PCR Length: 2187 bp. Deletion Size: 1215 bp. Deletion left flank: CACACCCCATATGTTCAAAATTACAGTCTC. Deletion right flank: CGGCAAGAGCTTCATTTGCGTCGACCAACG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K08H10.4. Homozygous. Outer Left Sequence: CGAGCAACCTCATTCCATTT. Outer Right Sequence: TGCGCAATATTAATAGCCCC. Inner Left Sequence: AACGTCATGCTATTCCCTGC. Inner Right Sequence: GCAATGCCGCAAAACTAAAT. Inner Primer PCR Length: 2492 bp. Deletion Size: 866 bp. Deletion left flank: TAGTCAAATATTACATTTCATTAAAATATC. Deletion right flank: AGAAAATAAAAGGAATGGAGGTTTCATGGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K11H12.1. Homozygous. Outer Left Sequence: CCATGGGACAGACTGGAACT. Outer Right Sequence: CAAACCTACGGAAAGCCAAA. Inner Left Sequence: CTCGAGGGAAGCAGTGACTC. Inner Right Sequence: AGGATCCCAAGCCAAGAACT. Inner Primer PCR Length: 2167 bp. Deletion Size: 1116 bp. Deletion left flank: TACAACTAAAATCGAGCCGCGGCGCGCCGT. Deletion right flank: GAAAAATTGGTAAAGCCTATGAAAAAGTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F35H12.3. Homozygous. Outer Left Sequence: CCTCTTCCTCCTTTTCACCC. Outer Right Sequence: CGACAGTTGTGGTTTCCTCC. Inner Left Sequence: ACGTTTCAGATGCCTTCCAC. Inner Right Sequence: ATGATCCAGCGGGTACAAAA. Inner Primer PCR Length: 2248 bp. Deletion Size: 1525 bp. Deletion left flank: TCTGGTTGTTTTTACGATGAACACGATTAC. Deletion right flank: TCAGCTGAATATATTTTGTTCATTTAAAGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F57H12.7. Homozygous. Outer Left Sequence: CACAATCTCCGCTCAAGACA. Outer Right Sequence: CTCGGAGCTTCCTACTGGTG. Inner Left Sequence: CGCAGCCGTTTTAATTTTGT. Inner Right Sequence: TTTTGAGGAATCGGGTGAAG. Inner Primer PCR Length: 2752 bp. Deletion Size: 1977 bp. Deletion left flank: TGGTACCCATCTCTCTCTCTCTCTCCGTCC. Deletion right flank: AATTTATTTTTAAAAAATTATATTCGGACC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K01H12.2. Homozygous. Outer Left Sequence: TCCGTGATATGTTGTTCCGA. Outer Right Sequence: AGAGCCTGCCTACATGGCTA. Inner Left Sequence: TGTTTGCAAAATGATGCGAT. Inner Right Sequence: CAAGGTTCAGTTGCCTCCTC. Inner Primer PCR Length: 2111 bp. Deletion Size: 892 bp. Deletion left flank: ATCGACGATTCCTTTGTAACGTTTATCGGC. Deletion right flank: ATAATCGCAATCATTTTAAACCAAAAAGCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C29H12.3. Homozygous. Outer Left Sequence: CAGCATCTACCCGGACATCT. Outer Right Sequence: GGACAGTCAATGAAAGGGGA. Inner Left Sequence: AGAAATCGCAGGATTCCCTT. Inner Right Sequence: CTGATCTTCAAGCGGGAAAG. Inner Primer PCR Length: 3116 bp. Deletion Size: 1843 bp. Deletion left flank: TGTTAGATGTAAATTATAATTACTATGTTG. Deletion right flank: GCCAACGCGATGAACAATCTAGGAAAGGTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T10H10.1. Homozygous. Outer Left Sequence: GGGGAACGAAACCCATTAGT. Outer Right Sequence: TGGAAAACTGAACTCGAGCA. Inner Left Sequence: TCAAAACCGAAAGAGCACAA. Inner Right Sequence: GCTCTCGATCATCAACCACA. Inner Primer PCR Length: 3314 bp. Deletion Size: 2881 bp. Deletion left flank: TGTACCACACCACAGCTTCGCAGACACCAC. Deletion right flank: TTAGTCTAGTCTGTGTCAATTTTGTTTCAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T10H10.1. Homozygous. Outer Left Sequence: GGGGAACGAAACCCATTAGT. Outer Right Sequence: TGGAAAACTGAACTCGAGCA. Inner Left Sequence: TCAAAACCGAAAGAGCACAA. Inner Right Sequence: GCTCTCGATCATCAACCACA. Inner Primer PCR Length: 3314 bp. Deletion Size: 1767 bp. Deletion left flank: CACCCCTACCTGTACCACACCACAGCTTCG. Deletion right flank: GGTTTAGTCTGTATATTGCACTTTTTGATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C10H11.1. Homozygous. Outer Left Sequence: GCGCCGAAAAAGTACAAAAA. Outer Right Sequence: AGTAATGACGGTTTCACCGC. Inner Left Sequence: TTGTGCAGGAGAAACGTGAG. Inner Right Sequence: TGCATCGTTCTGTTTCCAAG. Inner Primer PCR Length: 3296 bp. Deletion Size: 2472 bp. Deletion left flank: GGATCGAAGAATGTCGATGTGAGACTTGTA. Deletion right flank: GTTGTGTACAAAGGAGCAGAACCTGAGCAG. Insertion Sequence: CT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y66H1A.6. Homozygous. Outer Left Sequence: AATTTTCGGCAATCGACACT. Outer Right Sequence: GATGCATTTGAATGAGGCAA. Inner Left Sequence: TTGACGGAATTCCCAAAAAT. Inner Right Sequence: CTCACCACAATGGCCAAATA. Inner Primer PCR Length: 3122 bp. Deletion Size: 1206 bp. Deletion left flank: AAAGTCCATTTCCTTTCAATTCAAATAACT. Deletion right flank: AATGTCTCGAAAACGGTTTAAAAGAGTAAA. Insertion Sequence: TTTTCCTTTCAATTTCAAATAAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y51H1A.4 Homozygous. Outer Left Sequence: tttccagattttctcgcgtt. Outer Right Sequence: tttcgcactgttttctcgtg. Inner Left Sequence: aagtgaaggaaatgccgaaa. Inner Right Sequence: ccaatgcatctcatcctcct. Inner Primer PCR Length: 2570. Deletion size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F45H10.4 Homozygous. Outer Left Sequence: aacgaacgagttcaattggc. Outer Right Sequence: ggccaccgatttttcctatt. Inner Left Sequence: taaagcaatttccccacagg. Inner Right Sequence: ttacggccacatagcaaaaa. Inner Primer PCR Length: 3175. Deletion size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F35H12.2 Homozygous. Outer Left Sequence: cccaacaccttcagtcaggt. Outer Right Sequence: acctccatcctcaacacagg. Inner Left Sequence: ggaatactgggttttccgct. Inner Right Sequence: ggaagggacacacggaagta. Inner Primer PCR Length: 3288. Deletion size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y66H1B.2. Homozygous. Outer Left Sequence: AGCGAGTCCAGTGTCGATTT. Outer Right Sequence: CGCTTACCGAAAATGCAAGT. Inner Left Sequence: GACGTCCTGGGAAGAACTTG. Inner Right Sequence: TCCAAAACTTTAAACCGCCA. Inner Primer PCR Length: 3218 bp. Deletion Size: 1763 bp. Deletion left flank: TTAAAAATATTGAGTTTCAACAATTTTACA. Deletion right flank: ATCGCGTAGACTCCTGGTTCTGTTGGAGTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C32H11.12. Homozygous. Outer Left Sequence: TTCCGTGATCACAATTGACC. Outer Right Sequence: GGTTAACCTCCCCAATTCGT. Inner Left Sequence: TGTGTCCCGAGTAACAACCA. Inner Right Sequence: ATTGTCGTCACTTTTCGGCA. Inner Primer PCR Length: 1260 bp. Deletion Size: 401 bp. Deletion left flank: CCATGAACAGTGGATAATCGATGAGCTTAT. Deletion right flank: TTCTGGAGCCTGAATAGAACTATATTTAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y92H12A.1 Homozygous. Outer Left Sequence: ctggcaccacgtgatatttg. Outer Right Sequence: tatccgctcacctctgcttt. Inner Left Sequence: catttacatggtggtgagcg. Inner Right Sequence: attcctcggcacataaccag. Inner Primer PCR Length: 2697. Deletion size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F36H12.8. Homozygous. Outer Left Sequence: CAATGCAGGTGCTCAAAATG. Outer Right Sequence: GAATGACCTCGTTCCCTTGA. Inner Left Sequence: AAGTGTTGGTGCTCGGAGAG. Inner Right Sequence: CCAAAACCACATACTTCGGC. Inner Primer PCR Length: 1207 bp. Deletion Size: 525 bp. Deletion left flank: AAGCTCTTGAGGATCTCCACAACATTGGAT. Deletion right flank: TGCTATAGAGTTAGTTGAACTTATAGTAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F57H12.3. Homozygous. Outer Left Sequence: CGCTGAGATCAGCATCAAAA. Outer Right Sequence: CAGAATGTTTTTCGCCCAAT. Inner Left Sequence: CGGAGAAAGGGGGTATGTTT. Inner Right Sequence: GGGAAATCGGGAATGAATAAA. Inner Primer PCR Length: 1158 bp. Deletion Size: 464 bp. Deletion left flank: TCAGCTGCTCTTCTTCTTTTGACTATTGTA. Deletion right flank: GAAATCATGGAATCTCTTCCAAAGGATGTT. Insertion Sequence: AAAAAAAAAAAAGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F57H12.3. Homozygous. Outer Left Sequence: CGCTGAGATCAGCATCAAAA. Outer Right Sequence: CAGAATGTTTTTCGCCCAAT. Inner Left Sequence: CGGAGAAAGGGGGTATGTTT. Inner Right Sequence: GGGAAATCGGGAATGAATAAA. Inner Primer PCR Length: 1158 bp. Deletion Size: 312 bp. Deletion left flank: ACTACAAACATTCCAGCGTCCACCACCACC. Deletion right flank: GAAGAAATTCCAAGAATTCAAAGAGAAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807