| OH16834 |
C. elegans |
otTi71. Show Description
otTi71 [UPN::lin-4::unc-54 3UTR]. single copy insertion of panneuronally expressed lin-4 pri-miRNA. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
|
|
| OH16836 |
C. elegans |
otIs669 V; otIs115. Show Description
otIs115 [gcy-12p::GFP]. Integrated promoter fusion reporter for gcy-12. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. References: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2. Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
|
|
| OH16837 |
C. elegans |
him-8(e1489) IV; nlp-45(ot1032[nlp-45::T2A::GFP::H2B]) X; otEx7578. Show Description
otEx7578 [rab-3p::fem-3::SL2::TagRFP + inx-6(prom18)::TagRFP]. Panneuronal overexpression of fem-3 causes panneuronal masculation. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
|
|
| OH16848 |
C. elegans |
him-5(e1490)V; otIs518; otIs773. Show Description
otIs518 [eat-4(fosmid)::SL2::mCherry::H2B + pha-1(+)]. otIs773 [inx-19(fosmid)::SL2::YFP::H2B + unc-122::GFP + pha-1(+)]. Integrated fosmid transcriptional reporter for inx-19.
|
|
| OH16866 |
C. elegans |
otIs810. Show Description
otIs810 [sto-3p::tagRFP + sto-3p::GFP::cla-1]. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
|
|
| OH16917 |
C. elegans |
pha-1(e2123) III; otEx7693. Show Description
otEx7693 [F23H12.7p(RIM)::tagRFP + pha-1(+)]. Maintain at 25C to retain array. RIM neurons marked with RFP. Can be used to isolate RIM by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
|
|
| OH16925 |
C. elegans |
him-8(e1489) IV; ceh-24(syb1608[ceh-24::GFP]) V. Show Description
Him. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-24 locus; verified by sequencing. Derived by crossing him-8 into parental strain PHX1608. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
|
|
| OH16932 |
C. elegans |
casy-1(ot1108[casy-1::T2A::GFP::H2B]) II. Show Description
SL2::GFP::H2B tag inserted at C-terminus of endogenous casy-1 locus.
|
|
| OH16940 |
C. elegans |
ceh-20(ok541) III; otIs643 V; muEx261. Show Description
otIs643 [npr-9::TagRFP + rol-6(su1006)] V. muEx261 [ceh-20::GFP + odr-1::RFP]. Pick RFP+ animals to maintain. Rollers.
|
|
| OH16949 |
C. elegans |
otIs736; evIs111. Show Description
otIs736 [cat-4p::mCherry + rol-6(su1006)]. evIs111 [F25B3.3::GFP + dpy-20(+)]. Rollers. Pan-neural GFP expression. The two HSN neurons are marked with both GFP and mCherry. Can be used to isolate HSN by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
|
|
| OH16952 |
C. elegans |
pha-1(e2123) III; otEx7568. Show Description
otEx7568 [nlp-17::GFP + pha-1(+)]. Maintain at 25C to retain array. PVQ neurons marked with GFP. Can be used to isolate PVQ by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
|
|
| OH16971 |
C. elegans |
otIs816. Show Description
otIs816 [klp-6p::mCherry + klp-6p::GFP::cla-1]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
|
|
| OH17000 |
C. elegans |
cdh-3(ot1096[cdh-3::T2A::GFP::H2B]) III. Show Description
SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-3 locus.
|
|
| OH17002 |
C. elegans |
cdh-10(ot1118[cdh-10::T2A::GFP::H2B]) IV. Show Description
SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-10 locus.
|
|
| OH17019 |
C. elegans |
otIs825. Show Description
otIs825 [degl-1p::GFP + unc-122p::GFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
|
|
| OH17030 |
C. elegans |
cdh-12(ot1119[cdh-12::T2A::GFP::H2B]) III. Show Description
SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-12 locus.
|
|
| OH17051 |
C. elegans |
ceh-48(ot1125[ceh-48::GFP]) IV. Show Description
GFP tag inserted at the C-terminus of the endogenous ceh-48 locus by CRISPR. Allele obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
|
|
| OH17055 |
C. elegans |
ceh-38(tm321) II; ceh-44(ot1028) III; ceh-48(tm6112) IV; otDf1 X; otIs790. Show Description
otIs790 [UPN::npp-9::mCherry::blrp::3xflag]. otIs790 contains a pan-neuronal INTACT tag for pull-down of all neuronal nuclei. CUT sextuple-mutant background. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
|
|
| OH17058 |
C. elegans |
cdh-5(ot1127[cdh-5::T2A::GFP::H2B]) IV. Show Description
SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-5 locus.
|
|
| OH17064 |
C. elegans |
daf-16(ot971[daf-16::GFP]) otDf2 I. Show Description
otDf2 is a 25,484 bp deletion of the insulin cluster from Chr I, removing ins-28, ZC334.13, ins-29, ins-25, ins-27, linc-124, ZC334.12, ZC334.17, ins-24, ins-30, and ins-26. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH17072 |
C. elegans |
otIs833. Show Description
otIs833 [egas-4p::TagRFP + unc-122p::GFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
|
|
| OH171 |
C. elegans |
otEx103. Show Description
otEx103[lim-7::GFP; rol-6(su1006)]. <50% penetrant Roller line. Maintain by picking Rollers. GFP strongly expressed in gonad sheath cell pair 1.
|
|
| OH17124 |
C. elegans |
otIs837. Show Description
otIs837 [unc-25(prom3)(del1)::GFP]. RME neurons are labeled with GFP. Can be used to isolate RME by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
|
|
| OH17156 |
C. elegans |
cdh-5(ot1093) IV; him-5(e1490) V; dzIs89 X. Show Description
dzIs89 [inx-1p::BirA::nrx-1 + gcy-13p::AP::nlg-1 + gcy-13p::tagBFP + unc-122p::stretavadin::tagRFP] X. cdh-5(ot1093) is a CRISPR/Cas9 engineered deletion of full cdh-5 locus. Reference: Majeed M, et al. Sci Adv. 2025 Feb 21;11(8):eads2852. doi: 10.1126/sciadv.ads2852. PMID: 39983000.
|
|
| OH172 |
C. elegans |
lin-15B&lin-15A(n765) X; otEx105. Show Description
otEx105 [lim-7::GFP + lin-15(+)]. Highly penetrant line, but non-Muv/Muv does not correlate well with presence/absence of extrachromosomal array. Maintain by picking GFP-positive animals under GFP-dissecting scope. GFP strongly expressed in gonad sheath cell pair 1.
|
|
| OH17211 |
C. elegans |
pha-1(e2123) III; otEx7567. Show Description
otEx7567[nlp-56p::GFP + pha-1(+)]. RMG neurons are labeled with GFP. Can be used to isolate RMG by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
|
|
| OH17217 |
C. elegans |
otIs846. Show Description
otIs846 [egas-1p::GFP + unc-122p::GFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
|
|
| OH17225 |
C. elegans |
otEx7760. Show Description
otEx7760 [cat-4p::mCherry + zig-3p::mCherry + zig-3p::NLG1::GFP1-10 + cat-4p::NLG1::GFP11 + inx-6(prom18)::TagRFP]. BDU-HSN GRASP synaptic reporter. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH17241 |
C elegans |
unc-86(ot1158) III. Show Description
unc-86(ot1158) is a CRISPR-engineered null allele removing the entire unc-86 coding region. Very slightly Unc. The repair ssODN is TCTGTCTCCTCCCAGCTTCAAGGTCCCCCTCTTTTACCTTGATTCTTTGATTAGTTTCGTTTTCGTGAAC, and the two sgRNAs are acaacatacaatgggctacc (start) caaggtccccctcttttcca (end). References: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792. Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095.
|
|
| OH17294 |
C. elegans |
npr-37(syb4440[npr-37::SL2::GFP::H2B]) IV; otIs669 him-5(e1490) V. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
|
|
| OH17368 |
C. elegans |
otIs854. Show Description
otIs854 [unc-39p::tagRFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
|
|
| OH17489 |
C. elegans |
egIs1 IV; otIs860. Show Description
egIs1 [dat-1p::GFP]; reportedly maps to LG IV. otIs860 [flp-33p::tagRFP]. CEP neurons are marked with bright green expression (dat-1p::GFP), and can be sorted by selecting the brightest GFP. there are other cells in which the GFP marker shows up, but expression is faint. Other fluorescing neurons (ADE and PDE) will be double positive (GFP and tagRFP). Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
|
|
| OH17492 |
C. elegans |
him-5(e1490) V; otEx7809. Show Description
otEx7809 [flp-7p::TagRFP + inx-1::tagRFP + flp-7p::NLG1::GFP1-10 + inx-1p::NLG1::GFP11]. Him. AIB-SAA GRASP synaptic reporter. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH17502 |
C. elegans |
otIs867. Show Description
otIs867 [srh-71p::GFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
|
|
| OH17513 |
C. elegans |
unc-86(ot1184) III; ric-4(syb2878[ric-4::T2A::3xNLS::GFP]) V. Show Description
Null allele of unc-86 generated by gRNAs targeted to the first and last exons, resulting in a 3202 bp deletion from -8 to +3194 relative to the start of the ORF. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
|
|
| OH17514 |
C. elegans |
ric-4(syb2878[ric-4::T2A::3xNLS::GFP]) V; ceh-14(ot1185) X. Show Description
Null allele of ceh-14 generated by gRNAs targeted to the first and last exons, resulting in a 4056 bp deletion from +40 to +4096 relative to the start of the ORF. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
|
|
| OH17515 |
C. elegans |
unc-30(ot1186) IV; ric-4(syb2878[ric-4::T2A::3xNLS::GFP]) V. Show Description
Null allele of unc-30 generated by gRNAs targeted to the first and last exons, resulting in a 5168 bp deletion from -37 to +5131 relative to the start of the ORF. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
|
|
| OH17582 |
C. elegans |
daf-16(ot853[daf-16::mNG::AID*]) I; otSi2 II; daf-2(e1370) III. Show Description
otSi2 [ges-1p::TIR1(F79G)::mRuby::unc-54 3'UTR + Cbr-unc-119(+) *ieSi61] II. Temperature-senstive daf(c): maintain at 15C. Intestine-specific TIR1 sequence in ieSi61 allele was edited to TIR1(F79G) using CRISPR/Cas9 to make it compatible with AID2. [TCC GTC GAG CTC AAG GGA AAG CCA CAC TTC] edited to [AGT GTC GAA TTG AAG GGA AAG CCA CAC GGA]. This strain can be used to deplete DAF-16 specifically from the intestine with the modified auxin 5-Ph-IAA. Constitutive dauer formation at 25 C due to daf-2(e1370). Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH17657 |
C. elegans |
unc-39(syb4537ot1193[unc-39p(bs_del)::unc-39::gfp]) V. Show Description
ot1193 is a CRISPR-engineered mutation of a small unc-39 auto-regulatory region containing a cluster of several predicted homeodomain binding sites in the endogenously-tagged unc-39(syb4537) reporter strain. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
|
|
| OH17726 |
Pristionchus pacificus |
unc-3(ot5008) X. Show Description
severe unc
|
|
| OH17751 |
C. elegans |
otEx7895. Show Description
otEx7895 [nmr-1p::CyoFP + flp-3p::mNeptune + gcy-35p::mNeptune flp-7p::tagRFP + klp-6::tagRFP + C42D4.1::GFP]. Pick animals with red or green fluorescence to maintain. AxoPAL strain for visualizing axonal neighborhoods. Reference: Majeed M, et al. Sci Adv. 2025 Feb 21;11(8):eads2852. doi: 10.1126/sciadv.ads2852. PMID: 39983000.
|
|
| OH17766 |
C. elegans |
ins-3(syb5421[ins-3::SL2::GFP::H2B]) II; otIs669 him-5(e1490) V. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
|
|
| OH17767 |
C. elegans |
ins-6(syb5463[ins-6::SL2::GFP::H2B]) II; otIs669 him-5(e1490) V. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. PLoS Genet. 2022 Sep 30;18(9):e1010372. doi: 10.1371/journal.pgen.1010372. PMID: 36178933.
|
|
| OH17768 |
C. elegans |
ins-24(syb5447[ins-24::SL2::GFP::H2B]) I; otIs669 him-5(e1490) V. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
|
|
| OH17801 |
C. elegans |
him-5(e1490) V; otIs870. Show Description
otIs870 [mir-228p::3xNLS::TagRFP] Pan-glial expression of tagRFP reporter. Him. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452.
|
|
| OH17826 |
C. elegans |
ins-30(syb5526[ins-30::SL2::GFP::H2B]) I; otIs669 him-5(e1490) V. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
|
|
| OH17870 |
C. elegans |
lin-11(ot1026) I; unc-17(syb4491[unc-17::T2A::GFP::H2B]) IV; otIs669 him-5(e1490) V. Show Description
Egl. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
|
|
| OH17874 |
C. briggsae |
Cbr-dpy-10(ot1210) II. Show Description
Dpy Rol. Heterozygotes are Left-handed Rol. R92C mutation in Cbr-dpy-10 generated via CRISPR/Cas9. Homologous to the C. elegans dpy-10(cn64) mutation.
|
|
| OH17918 |
C. elegans |
lep-5(ot1215[lep-5p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) X. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the lep-5 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. Males exhibit typical leptoderan tails.
|
|
| OH17921 |
C. elegans |
linc-3(ot1217[linc-3p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) V. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-3 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in dauers.
|
|
