T10H10.1. Homozygous. Outer Left Sequence: GGGGAACGAAACCCATTAGT. Outer Right Sequence: TGGAAAACTGAACTCGAGCA. Inner Left Sequence: TCAAAACCGAAAGAGCACAA. Inner Right Sequence: GCTCTCGATCATCAACCACA. Inner Primer PCR Length: 3314 bp. Deletion Size: 2881 bp. Deletion left flank: TGTACCACACCACAGCTTCGCAGACACCAC. Deletion right flank: TTAGTCTAGTCTGTGTCAATTTTGTTTCAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T10H10.1. Homozygous. Outer Left Sequence: GGGGAACGAAACCCATTAGT. Outer Right Sequence: TGGAAAACTGAACTCGAGCA. Inner Left Sequence: TCAAAACCGAAAGAGCACAA. Inner Right Sequence: GCTCTCGATCATCAACCACA. Inner Primer PCR Length: 3314 bp. Deletion Size: 1767 bp. Deletion left flank: CACCCCTACCTGTACCACACCACAGCTTCG. Deletion right flank: GGTTTAGTCTGTATATTGCACTTTTTGATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T10H10.1. Heterozygotes are WT and segregate WT, arrested szT1 aneuploid progeny, Lon-2 males, WT males, and homozygous ok632 hermaphrodites (arrest stage/phenotype undetermined). WT males apparently are viable ok632 hemizygotes, as they are positive for ok632 by PCR. Lon males negative for ok632 by PCR. Viable homozygous ok632 hermaphrodites have not been recovered. Pick WT L4 hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 10872 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TAGTATATTTTCTCAGGGTGACTTCATCTG ; Right flanking sequence: ttttGCAGAGTGTCAGGCGCGTGAATTAGG. sgRNA #11: aaaaGATAAACTCACGACAG; sgRNA #21: GATTGAGCCCGGAAAAACAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.