Search Strains

More Fields
Strain Species Genotype Add
VC257 C. elegans htp-1(gk150) IV. Show Description
F41H10.10. Him, small broods of viable progeny, many arrested embryos. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2570 C. elegans Y92H12A.2 (ok3321) I. Show Description
Y92H12A.2. External left primer: AAATACAATGCTCTCGCGCT. External right primer: GTAAGCGGCAAACGATTTTT. Internal left primer: TCTACGGGTCCGTCTATTGC. Internal right primer: ACTTCGAAACACTTTCCGGC. Internal WT amplicon: 1132 bp. Deletion size: 538 bp. Deletion left flank: AAAATTACAAGCTTTTAGAGGAAAAATTGA. Deletion right flank: GATTGTCTTATTTTGGCTTGATCTACGTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2594 C. elegans F20H11.1(ok3386) III. Show Description
F20H11.1. External left primer: CAGCAACTCCATCAAAGCAA. External right primer: CGTTTCTGCCGATTTTTCAT. Internal left primer: AGTTGACAGAACTCCGGCAC. Internal right primer: TTTTGGCTAGAGAATCACAAAAA. Internal WT amplicon: 1279 bp. Deletion size: 472 bp. Deletion left flank: GTGCAAAAAAAACAATTTCTCCAGACCGGG. Deletion right flank: AAGGAGTTGAAGATTGATTATGAGCATCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2795 C. elegans F36H12.9(gk1123) IV. Show Description
F36H12.9. Identified by PCR, validated by CGH. External left primer: TGTTGTGGAAGTGCAAGAGG. External right primer: CGTATCGGTTAGTCGGCATT. Internal left primer: GCCTCAGCGATATGGAGAAG. Internal right primer: AGAAATCCTTTGTCGATGCG. Internal WT amplicon: 1008 bp. Deletion size: 761 bp. Deletion left flank: TACTCCGCCTCAGCGATATGGAGAAGTTTG. Deletion right flank: ATATATTGTTTTCAGTACTTGGATACTCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2826 C. elegans C09H10.7(ok2466)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C009H10.7. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2466 homozygotes (sterile adult, no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CAAATTTCCAGGTTCGTCGT. External right primer: TTCCTGTTCGAAACGAGGTT. Internal left primer: GTGGATGCTCCAACTGACAA. Internal right primer: TGACGATTTGAATGTCTGATACAA. Internal WT amplicon: 1330 bp. Deletion size: 550 bp. Deletion left flank: TATACTTGTATGAGTGAAGAATTTGATGAT. Deletion right flank: TCATCCAGCGAACAAACCTTCCACCATCAC. Insertion Sequence: CCATCGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2857 C. elegans F45H11.6(gk1216) I; F09A5.2(gk3060) X. Show Description
F45H11.6, F09A5.2. The allele gk1216 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: TCCTTATCGGGTGACTCCAG. External right primer: TAAGGCGCTGCTTTGATTTT. Internal left primer: GGACGGACACGTTTCAAATC. Internal right primer: TATTATTTGCCTGCTTCCGC. Internal WT amplicon: 1801 bp. Deletion size: 646 bp. Deletion left flank: GATGAAGAATGAGAAAGGAAATATTTGAAG. Deletion right flank: AATAATGTTGTCTGGTACAGGTATCAAATC. The allele gk3060 was identified by CGH but not confirmed by PCR. Left flanking probe: ATCAGCATGTTGGGATGTGTGTCAAATCCATATGAGCCATTGATCGTGGT. Right flanking probe: TGGTGAGTGACCTTTCCATAAACCGAATTACCTCGGAAAATGTTTTTAGA. Left deleted probe: ATCAGCATGTTGGGATGTGTGTCAAATCCATATGAGCCATTGATCGTGGT. Right deleted probe: GAGAAGACATAAAGATTATGTGCTGATGGTGAGTGACCTTTCCATAAACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2916 C. elegans F45H11.6(gk1242) I. Show Description
F45H11.6. External left primer: TCCTTATCGGGTGACTCCAG. External right primer: TAAGGCGCTGCTTTGATTTT. Internal left primer: GGACGGACACGTTTCAAATC. Internal right primer: TATTATTTGCCTGCTTCCGC. Internal WT amplicon: 1801 bp. Deletion size: 572 bp. Deletion left flank: GAAATATTTGAAGTAAAAATAATAATACAT. Deletion right flank: TTGAATGCCAGTTTTAAGGCACACACTGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2953 C. elegans C46H11.3(ok3704) I. Show Description
C46H11.3. Homozygous viable deletion, detectable by nested PCR. External left primer: AATTTTACACCCCCTCCAGC. External right primer: GGAGTCTCCGATTGTCCAAA. Internal left primer: GTCCTTGTTTTTGTTGGTTTTT. Internal right primer: AGCTCAATGCCCACTCACTT. Internal WT amplicon: 1318 bp. Deletion size: 391 bp. Deletion left flank: AATTTTTGAATAAATAATAATATTTCAATA. Deletion right flank: CAGGGATCCATTGTTCGAGTGTTGTCCAAT. Insertion sequence at break: GGATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3146 C. elegans fln-1(gk3291) IV; cdf-1(gk3543) X. Show Description
This strain is homozygous for a deletion (gk2191) in Y66H1B.2, detectable by PCR using the following primers. External left primer: AGCGAGTCCAGTGTCGATTT. External right primer: ACGTGAAGCTGGAGAGCATT. Internal left primer: GACATCCTTAATCCGGACCC. Internal right primer: AGAACCAGGAGTCTACGCGA. Internal WT amplicon: 1864 bp. Deletion size: 1225 bp. Deletion left flank: ATGGATTAGATACTTCTCTTCTAACTTTAT. Deletion right flank: CATTTTTATTTCCTAGTGAATATTACCTTA. Insertion Sequence: TTTTCCCATATTTCAGATATTACTACAATACGCTCGGTA. Validation: gk3291 passed by CGH. Other deletion (gk3543) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3182 C. elegans kbp-3(ok3713)/mT1 II; +/mT1 [dpy-10(e128)] III. Show Description
F26H11.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3713 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATCGTCTTCTTCGTCGTCGT. External right primer: ATCGGCTTTTCTCAAGTGGA. Internal left primer: TCGTCTTCCTCATCATCATCC. Internal right primer: TGCTAATTTTGCTGTCGCAT. Internal WT amplicon: 1133 bp. Deletion size: 434 bp. Deletion left flank: CAAAATTTTTACCGCTCTTCAGTGCCGCCC. Deletion right flank: ACATCTAAACAATTTCCTTGCAAATTTACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3183 C. elegans F45H11(gk3128) I. Show Description
F45H11. External left primer: CGCGATGAGACCCATCTATT. External right primer: CGACAATGTGGTCGTTTTTG. Internal left primer: CTTGTGTCGATTTACGGGCT. Internal right primer: ATGGAAGAGTGCAAGTTCGG. Internal WT amplicon: 1685 bp. Deletion size: 107 bp. Deletion left flank: GAGAGACGCAGCAGCTTACTACGCAGTTAT. Deletion right flank: AAATATATTATTGAGAAAAGAAGAAGAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC319 C. elegans +/mT1 II; tbx-2(ok529)/mT1 [dpy-10(e128)] III. Show Description
F21H11.3. Heterozygotes are WT and segregate WT, arrested mT1 aneuploid progeny, sterile Dpy-10 mT1 homozygotes, and homozygous ok529 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3205 C. elegans R05D7.1(gk3201) I; alh-4(gk3187) V; clh-4(gk3202) C24H10.2(gk3203) X. Show Description
This strain is homozygous for a deletion (gk3187) in T05H4.13, detectable by PCR using the following primers. External left primer: AAGGACCTTCGAAACATAAGGAG. External right primer: ATCTCCACCCTCCCAATTAAATA. Internal left primer: AAGCAGGTGCTGACTGTGTG. Internal right primer: CATTCCAAATTTCGGCAGTT. Internal WT amplicon: 2323 bp. Deletion size: 512 bp. Deletion left flank: ACCACTGCTAGTCTCATTCAAAAGGCGTTT. Deletion right flank: GATCAAAAATGGAGGAAAAATCAACAAAAA. Validation: gk3187 passed by CGH. Other deletions (gk3201, gk3202, gk3203) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3242 C. elegans gcy-13(gk3189) V. Show Description
This strain is homozygous for a deletion (gk3189) in F23H12.6, detectable by PCR using the following primers. External left primer: CATCCTTTCCTGCACCTCAT. External right primer: CGCCGTACAATTGTGTTGAC. Internal left primer: CTTACCCAGACCTGCCAGAA. Internal right primer: TTGAAGGAATGTCGGGAGTT. Internal WT amplicon: 1579 bp. Deletion size: 530 bp. Deletion left flank: TATTTTAACTTGCCATCTGTCATTTATATA. Deletion right flank: CGACCTTTTATTATTGATTGAAGCATTCCA. Validation: gk3189 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3267 C. elegans ned-8(gk3086) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous sterile deletion chromosome (gk3086 in F45H11.2) balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3086 homozygotes (late larval arrest or sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGCGATGAGACCCATCTATT. External right primer: CGACAATGTGGTCGTTTTTG. Internal left primer: CTTGTGTCGATTTACGGGCT. Internal right primer: ATGGAAGAGTGCAAGTTCGG. Internal WT amplicon: 1685 bp. Deletion size: 1145 bp. Deletion left flank: ATTCTCAGGATTTTTTGTTACCATAGTGTT. Deletion right flank: TCTTACAAATACTGCGCGTTCTGATCTCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3269 C. elegans gcy-13(gk3118) V/nT1 [qIs51] (IV;V). Show Description
F23H12.6. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3118 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CATCCTTTCCTGCACCTCAT. External right primer: CGCCGTACAATTGTGTTGAC. Internal left primer: CTTACCCAGACCTGCCAGAA. Internal right primer: TTGAAGGAATGTCGGGAGTT. Internal WT amplicon: 1579 bp. Deletion size: 310 bp. Deletion left flank: GATACTTCCACGACTACAATATCTCCAAAA. Deletion right flank: ACAATCCATTGATCATCTAATCTTAACTCT. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3278 C. elegans dhs-22(gk3197) gkDf30 V. Show Description
This strain is homozygous for a deletion (gk3197) in C15H11.4, detectable by PCR using the following primers. External left primer: AATGTCCTCATTCAGACGGC. External right primer: TTGACCCCGCTGGATACTAC. Internal left primer: CCGAGAAGGAGAAACTGACG. Internal right primer: GCCATTGAGGCTCTTCAGAC. Internal WT amplicon: 1991 bp. Deletion size: 1301 bp. Deletion left flank: AATAGAGAAATTATTGTAGCTGCGCTGGCA. Deletion right flank: ACTAAAAAATAAATAACAGGGATTGCGAAA. Validation: gk3197 passed by CGH. Other deletion (gkDf30) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC377 C. elegans elo-5(gk182) IV. Show Description
F41H10.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4095 C. elegans srz-5(gk5186) II; R09H10.7(gk5187) IV; F54B11.7(gk5188) X. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5186 mutation is C->T, flanking sequences TCCGAGATATAGCAGAATTATGATCCAGGA and CAATTTTTTTGATTTAAAATCCATTTTTTG. The gk5187 mutation is G->A, flanking sequences AGATATGAGCGAAGATAAAGTTCTTATTAG and TAAGTAGCTTATTTTTTTAGAAAAAAACAT. The gk5188 mutation is C->T, flanking sequences GAAATCGCCAACATCAACCATTCAGTTAAA and AGCTTCTAACTGATATGGATACGGTGAAAG.
VC410 C. elegans elo-5(gk208) IV. Show Description
F41H10.7. Superficially wild-type. Strain does not tolerate hypochlorite treatment well and does not grow well in absence of the contaminating bacteria. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC425 C. elegans elo-6(gk233) IV. Show Description
F41H10.8. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4312 C. elegans F39H12.2(gk5395[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 2876 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: ACTGAGAGAGAGAAAGCTAGTTAGCCGCGG. Right flanking sequence: CATGGGAGCGCAATTCACAAATGGACGCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC435 C. elegans +/szT1 [lon-2(e678)] I; hum-6(ok632)/szT1 X. Show Description
T10H10.1. Heterozygotes are WT and segregate WT, arrested szT1 aneuploid progeny, Lon-2 males, WT males, and homozygous ok632 hermaphrodites (arrest stage/phenotype undetermined). WT males apparently are viable ok632 hemizygotes, as they are positive for ok632 by PCR. Lon males negative for ok632 by PCR. Viable homozygous ok632 hermaphrodites have not been recovered. Pick WT L4 hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4570 C. elegans F26H11.8(gk5641[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 537 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AACCATAAATATAATCGAATCAAAATTCCT. Right flanking sequence: TCTTCGTCGTCGTCCTCGTCTTCCTCATCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4610 C. elegans H12I13.1(gk5680[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 5113 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTATTTACATTAAAATGAACTAACCTCCA. Right flanking sequence: CTGGCTTAGAATCTCAAGCGACTGTAGTAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4624 C. elegans F35H10.5(gk5694[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 451 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AATCATGGTAATGCACATCAAACAGTCTAC. Right flanking sequence: CGTGTCACACAATCATTTCAATCGGAGTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4655 C. elegans R10H10.3(gk5724[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2220 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AGGAGAAAATGAGAAATGGAACAACCACGC. Right flanking sequence: TGTGGTGGATGTATGGGATTGGTTTGGCAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4675 C. elegans R10H10.4(gk5744[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1294 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CAACTAATTAATATTCATGTCCATCCTCAT. Right flanking sequence: GTTTGAGACACCATTCAAGCACTGAAACTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4828 C. elegans Y92H12BL.1(gk5896[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 11570 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: GGTGTTAAGCAGATTGATCGAATTGTTGAA. Right flanking sequence: GTTTATGGTAGCGGTATTGATTTTTCTTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC512 C. elegans +/szT1 [lon-2(e678)] I; hke-4.2(gk256)/szT1 X. Show Description
H13N06.5. Heterozygotes are WT and segregate WT, arrested szT1 aneuploids, lon-2 males, and gk256 homozygotes (arrest stage/phenotype uncertain). Mutant homozygotes may be viable, Dpyish animals with small broods of slow-growing, Unc progeny, but this has not been confirmed. WT length males are also segregated, and these may be mutant hemizygotes. Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC539 C. elegans kin-29(gk270) X. Show Description
F58H12.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC589 C. elegans kin-29(gk288) X. Show Description
F58H12.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC599 C. elegans C15H11.9&C15H11.8(gk284) V/nT1 [qIs51] (IV;V). Show Description
C15H11.9, C15H11.8. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP gk284 homozygotes (early larval arrest). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC624 C. elegans cor-1(ok869) III. Show Description
R01H10.3a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC642 C. elegans fbl-1(gk295) IV/nT1 [qIs51] (IV;V). Show Description
F56H11.1a. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP gk295 homozygotes (some make it to sterile adults). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC648 C. elegans nhr-38&K01H12.4(gk299) IV. Show Description
K01H12.3, K01H12.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC683 C. elegans elo-5(ok983) IV/nT1 [qIs51] (IV;V). Show Description
F41H10.7. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok983 homozygotes (early or mid-larval arrest). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC685 C. elegans +/szT1 [lon-2(e678)] I; hke-4.2(ok960)/szT1 X. Show Description
H13N06.5. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, arrested szT1 aneuploids, Lon-2 males and ok960 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC869 C. elegans bra-2(ok1171)/sC1 [dpy-1(s2170)] III. Show Description
F23H11.1. Homozygous viable deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok1171 homozygotes (sickly, slow-growing). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC978 C. elegans set-31(ok1482) V. Show Description
C15H11.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VH1075 C. elegans rhIs4 hdIs26 III; fmi-1(rh308) V. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III. hdIs26 [odr-2p::CFP + sra-6p::DsRed2] III. Ventral cord cross-over defects. PVQ axons sometimes stop short or leave the ventral cord. Reference: Steimel A, et al. Development. 2010 Nov;137(21):3663-73.
VH1160 C. elegans ast-1(hd92) II; rhIs4 III; hdEx237. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III. hdEx237 [ast-1(+) + rol-6(su1006)]. hd92 arrests as L1 due to pharyngeal differentiation defects; ventral cord midline crossing defects; rescued with ast-1(+) transgene. Rollers.
VH1195 C. elegans hdIs42. Show Description
hdIs42[ast-1::YFP + rol-6(su1006)]. GFP expression in neurons; contains full length AST-1 tagged with GFP at the C terminus. Rollers.
VH1312 C. elegans nas-6(hd108) IV. Show Description
Slow growth. Reduced rate of pumping and abnormal morphology of the grinder in pharynx. Reference: Park JO, et al. BMC Dev Biol. 2010 Jan 28;10:14.
VH1348 C. elegans nas-7(hd116) II. Show Description
Superficially wild-type. Reference: Park JO, et al. BMC Dev Biol. 2010 Jan 28;10:14.
VH1565 C. elegans rhIs4 hdIs26 III; fmi-1(hd121) V. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III. hdIs26 [odr-2p::CFP + sra-6p::DsRed2] III. Ventral cord cross-over defects. PVQ axons sometimes stop short or leave the ventral cord. Reference: Steimel A, et al. Development. 2010 Nov;137(21):3663-73.
VH17 C. elegans ast-1(rh300) II; rhIs4 III. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III. Ventral cord midline crossing defects.
VH1940 C. elegans cdh-4(hd40) III. Show Description
Partially penetrant embryonic and larval lethality. Variable morphological defects. Reference: Schmitz C, et al. Dev Biol. 2008 Apr 15;316(2):249-59.
VH7054 C. elegans R09H10.3(hd7054[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 695 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTAAGAAAACTCCGCACACAAACCTCATTT; Right flanking sequence: CCCTGGAACCTACCGATTGGTCTACATCAC. sgRNA #1: GCACACAAACCTCATTTCGA; sgRNA #2: CCCGATTTCACCCTAATCCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VX88 C. latens Show Description
Caenorhabditis sp. 23 Male-female strain. Caenorhabditis elegans wild isolate. H10. Isolated from soil near the lotus pond, Juifeng Village, Wuhan City, Hubei Province. Lat: 30°30'51"; Lon: 114°29'42".