K11H12.1. Homozygous. Outer Left Sequence: CCATGGGACAGACTGGAACT. Outer Right Sequence: CAAACCTACGGAAAGCCAAA. Inner Left Sequence: CTCGAGGGAAGCAGTGACTC. Inner Right Sequence: AGGATCCCAAGCCAAGAACT. Inner Primer PCR Length: 2167 bp. Deletion Size: 1116 bp. Deletion left flank: TACAACTAAAATCGAGCCGCGGCGCGCCGT. Deletion right flank: GAAAAATTGGTAAAGCCTATGAAAAAGTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Larval arrest. Deletion of 879 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ Venus+, and segregate wild-type GFP+Venus+, dim GFP+ arrested early larvae (ve979 homozygotes), and Venus+ dpy-9 (dpy-9(tm9713) kvs-5(tmIs1245) homozygotes). Pick WT bright GFP and check for correct segregation of progeny to maintain. [NOTE: ve979 deletion also removes K11H12.12 and K11H12.13, each of which encodes a snoRNA.] Left flanking Sequence: GAAAACTTTGGTGTTCTTTCTCTTCCAGTT; Right flanking sequence: TGGACGGCGCTCAACTGTCTGTAGTGCCAG. rpl-15 crRNA A: CTTGGCTTGGGATCCTCCGC; rpl-15 crRNA B: TGGTTGGGCGTGGGACACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.