| OH1876 |
C. elegans |
hst-2(ok595) X. Show Description
|
|
| OH18772 |
C. elegans |
ins-5(syb6245[ins-5::SL2::GFP::H2B]) II; otIs669 him-5(e1490) V. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. Reference: Fernandez RW, et al. Development. 2025 Aug 15;152(16):dev204958. doi: 10.1242/dev.204958. PMID: 40838983.
|
|
| OH18779 |
Pristionchus pacificus |
unc-25(ot5020) III. Show Description
unc
|
|
| OH18821 |
C. elegans |
nlp-18(ot1421[nlp-18::SL2::GFP::H2B]) II. Show Description
SL2::GFP::H2B tag inserted after STOP codon of endogenous nlp-18 locus using CRISPR/Cas9. The 15 first nucleotides of the standard SL2 sequence (immediately downstream of nlp-18 STOP) are missing but bright GFP fluorescence is clearly detectable. Generated in N2 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18826 |
C. tropicalis |
Ctr-nlp-11(ot1422[Ctr-nlp-11::SL2::GFP::H2B]) II. Show Description
SL2::GFP::H2B tag inserted after STOP codon of endogenous Ctr-nlp-11 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18829 |
C. briggsae |
Cbr-nlp-3(ot1423[Cbr-nlp-3::SL2::GFP::H2B]) X. Show Description
SL2::GFP::H2B tag inserted after STOP codon of endogenous Cbr-nlp-3 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18832 |
C. briggsae |
Cbr-nlp-18(ot1424[Cbr-nlp-18::SL2::GFP::H2B]) II. Show Description
SL2::GFP::H2B tag inserted after STOP codon of endogenous Cbr-nlp-18 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18835 |
C. elegans |
ins-7(ot1427) IV. Show Description
ot1427 is CRISPR-engineered 1,007 bp deletion removing the entire ins-7 coding region. Sequence after edit: CTTCGAAGGATAACCCCGAAGAAGCTGTTCCAAAACATAATGGTGGCTCTTCTGGATTTTGGGTTCAATT. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH18840 |
C. elegans |
hlh-32(ot1347) IV. Show Description
CRISPR/Cas9-engineered 1691 bp deletion removing entire hlh-32 locus; similar to syb6773 deletion. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
|
|
| OH18853 |
C. tropicalis |
Ctr-ceh-32(ot1430[Ctr-ceh-32::GFP]) V. Show Description
C-terminal GFP tag inserted before STOP codon of endogenous Ctr-ceh-32 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18854 |
C. briggsae |
Cbr-ceh-32(ot1431[Cbr-ceh-32::GFP]) V. Show Description
C-terminal GFP tag inserted before STOP codon of endogenous Cbr-ceh-32 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18863 |
C. elegans |
unc-18(ot1432(unc-18::SL2::GFP::H2B)) X. Show Description
Endogenous reporter generated by the insertion of SL2::GFP::H2B into the endogenous unc-18 locus. Expression in intestine and nervous system. Reference: Boeglin M, et al. Genetics. 2023 Dec 6;225(4):iyad180. doi: 10.1093/genetics/iyad180. PMID: 37793339.
|
|
| OH18871 |
C. elegans |
ceh-44(ot1433[*ot1015[ceh-44::gfp]]) III. Show Description
ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1433 is a deletion removing exons 4-7 from the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH18872 |
C. elegans |
ceh-44(ot1434[*ot1015[ceh-44::gfp]]) III. Show Description
ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1434 is a deletion removing exons 1-7 from the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH18892 |
C. briggsae |
Cbr-unc-17(ot1440[Cbr-unc-17::T2A::mScarlet3::H2B]) IV. Show Description
T2A::mScarlet3::H2B tag inserted before STOP codon of endogenous Cbr-unc-17 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18895 |
C. elegans |
ins-35(ot1443) V. Show Description
ot1443 is CRISPR-engineered 646 bp deletion of the ins-35 gene removing all the coding sequence except the last 7 aa, which should not be translated due to the absence of an ATG. Sequence after edit: ttctgaaatttttgaaattgtctaattttcCAGCAGACTCAGATGAACTATTCAATTAATAATTTAAGTT. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH18902 |
C. elegans |
degt-1(ot1445[degt-1::GFP]) V. Show Description
GFP tag inserted at the C-terminus of the endogenous degt-1 locus directly before the DEGT-1 stop codon. Reference: Bayer E, et al. 2025. biorxiv: https://www.biorxiv.org/content/10.1101/2025.01.01.631014v2
|
|
| OH18948 |
C. elegans |
ceh-44(ot1447[*ot1015[ceh-44::gfp]]) III. Show Description
ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1447 is a deletion removing exon 5 of the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH18961 |
C. tropicalis |
Ctr-nlp-3(ot1453[Ctr-nlp-3::SL2::GFP:H2B]) X. Show Description
SL2::GFP::H2B tag inserted after STOP codon of endogenous Ctr-nlp-3 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH19034 |
C. elegans |
degt-1(ot1466) V. Show Description
Null allele. ot1466 is a CRISPR-engineered deletion removing the complete CDS. Normal growth & viability. Reference: Bayer E, et al. 2025. biorxiv: https://www.biorxiv.org/content/10.1101/2025.01.01.631014v2
|
|
| OH19054 |
C. elegans |
pha-1 (e2123) III; otEx8199. Show Description
otEx8199 [sshk-1p::GFP + pha-1(+)]. Maintain at 25C. 370 bp of promoter directly upstream of sshk-1 fused to GFP. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
|
|
| OH19078 |
C. elegans |
daf-16(ot853[daf-16::mNG::AID*]) I; otIs908 V. Show Description
otIs908 [pha-4(prom2)::TIR1(F79G)::mTur2::tbb-2 3'UTR + unc-122p::mCherry::unc-54 3' UTR] V. TIR1(F79G) expression in all 22 enteric neurons (20 pharyngeal neurons, AVL and DVB), RIS and PVT. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19089 |
C. tropicalis |
Ctr-nlp-18(ot1474[Ctr-nlp-18::SL2::GFP:H2B]) II. Show Description
SL2::GFP::H2B tag inserted after STOP codon of endogenous Ctr-nlp-18 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH19094 |
C. briggsae |
Cbr-lgc-37(ot1475[Cbr-lgc-37::T2A::mScarlet3::H2B]) III. Show Description
T2A::mScarlet3::H2B tag inserted before STOP codon of endogenous Cbr-lgc-37 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH19118 |
C. elegans |
otIs913 V. Show Description
otIs913 [pha-4(prom2)::daf-2(DN)::eBFP2::tbb-2 3 UTR + unc-122p::mCherry::unc-54 3' UTR] V. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. pha-4(prom2) drives expression of daf-2(DN) in all 22 enteric neurons (20 pharyngeal neurons, AVL and DVB), RIS and PVT. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19119 |
C. elegans |
cone-1(ot1485[*syb5500[cone-1::oxGFP]]) III. Show Description
syb5500 is an oxGFP tag inserted at the C-terminus of the endogenous cone-1 locus by CRISPR. ot1485 is an early stop codon introduced into exon 3 of the endogenously-tagged cone-1 locus. Pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH19120 |
C. elegans |
ceh-44(ot1486[*ot1015[ceh-44::gfp]]) III. Show Description
ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1468 is an early stop codon introduced into exon 3 of the endogenously-tagged ceh-44 locus. Pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH19123 |
C. tropicalis |
Ctr-lgc-37(ot1487[Ctr-lgc-37::T2A::mScarlet3::H2B]) III. Show Description
T2A::mScarlet3::H2B tag inserted before STOP codon of endogenous Ctr-lgc-37 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH19124 |
C elegans |
pks-1(ot1488[pks-1::SL2::mScarlet-I3::H2B]) X. Show Description
SL2::mScarlet-I3::H2B tag inserted into endogenous pks-1 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534.
|
|
| OH19125 |
C elegans |
pks-1(ot1489[pks-1::SL2::GFP::H2B]) X. Show Description
GFP::H2B tag inserted into endogenous pks-1 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534.
|
|
| OH19186 |
C. elegans |
cone-1(ot1502[GFP::H2B::SL2::cone-1]) III. Show Description
GFP::H2B tag with SL2 inserted at N-terminus of endogenous cone-1 locus. Ubiquitous nuclear green at all stages (as early as 2-cell). GFP signal is very bright compared to C-terminal tag in OH19215. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH19202 |
C. briggsae |
Cbr-eat-4(ot1507[Cbr-eat-4::SL2::mScarlet3::H2B]) III. Show Description
SL2::mScarlet3::H2B tag inserted after STOP codon of endogenous Cbr-eat-4 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH19204 |
C elegans |
golg-4(ot1508[GFP::golg-4]) III. Show Description
GFP tag inserted into endogenous golg-4 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. Genetics. 2024 Oct 7;228(2):iyae126. doi: 10.1093/genetics/iyae126. PMID: 39103170.
|
|
| OH19205 |
C elegans |
golg-4(ot1509[mScarlet3::golg-4]) III. Show Description
mScarlet3 tag inserted into endogenous golg-4 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. Genetics. 2024 Oct 7;228(2):iyae126. doi: 10.1093/genetics/iyae126. PMID: 39103170.
|
|
| OH19206 |
C elegans |
golg-4(ot1510[mScarlet-I3::golg-4]) III. Show Description
mScarlet-I3 tag inserted into endogenous golg-4 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. Genetics. 2024 Oct 7;228(2):iyae126. doi: 10.1093/genetics/iyae126. PMID: 39103170.
|
|
| OH19210 |
C. elegans |
him-8(e1489) IV; unc-42(ot1187) V. Show Description
CRISPR/Cas9 full deletion removing the entire coding-region of unc-42. Him and Unc. Reference: Fernandez RW, et al. Development. 2025 Aug 15;152(16):dev204958. doi: 10.1242/dev.204958. PMID: 40838983.
|
|
| OH19211 |
C. tropicalis |
Ctr-eat-4(ot1512[Ctr-eat-4::SL2::mScarlet3::H2B]) III. Show Description
SL2::mScarlet3::H2B tag inserted after STOP codon of endogenous Ctr-eat-4 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH19212 |
C. tropicalis |
Ctr-unc-17(ot1513[Ctr-unc-17::T2A::mScarlet3::H2B]) IV. Show Description
T2A::mScarlet3::H2B tag inserted before STOP codon of endogenous Ctr-unc-17 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH19215 |
C. elegans |
cone-1(ot1514[cone-1::SL2::GFP::H2B]) III. Show Description
CRISPR reporter, substitution of SL2 for T2A. A broad nuclear expression begins around the Comma stage. Brighter expression with earlier initiation than T2A reporter. Expression becomes restricted to non-neuronal cells as animals mature to larval stages. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH19219 |
C. elegans |
ceh-44(ot1515[*ot1015[ceh-44::gfp]]) III. Show Description
ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1434 is a deletion removing exons 5-7 from the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH19232 |
C. elegans |
daf-16(ot853[daf-16::mNG::AID*]) I; otSi2 II. Show Description
otSi2 [ges-1p::TIR1(F79G)::mRuby::unc-54 3'UTR + Cbr-unc-119(+) *ieSi61] II. Intestine-specific TIR1 sequence in ieSi61 allele was edited to TIR1(F79G) using CRISPR/Cas9 to make it compatible with AID2. [TCC GTC GAG CTC AAG GGA AAG CCA CAC TTC] edited to [AGT GTC GAA TTG AAG GGA AAG CCA CAC GGA]. This strain can be used to deplete DAF-16 specifically from the intestine with the modified auxin 5-Ph-IAA. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19259 |
C. briggsae |
Cbr-unc-25(ot1524[Cbr-unc-25::SL2::mScarlet3::H2B]) III. Show Description
SL2::mScarlet3::H2B tag inserted after STOP codon of endogenous Cbr-unc-25 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH19278 |
C. elegans |
aex-4(ot1530[aex-4::SL2::gfp::his-44]) X. Show Description
SL2::GFP::HIS-44 tag inserted into the endogenous aex-4 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19280 |
C. elegans |
aex-5(ot1532[aex-5::SL2::gfp::his-44]) I. Show Description
SL2::GFP::HIS-44 tag inserted into the endogenous aex-5 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19295 |
C. elegans |
unc-25(ot1536[unc-25b.1::T2A::GFP::H2B]) III; him-5(e1490) V. Show Description
CRISPR-engineered T2A::GFP::H2B insertion specifically tags isoform b.1 of the endogenous unc-25 locus. Him. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452.
|
|
| OH19299 |
C elegans |
unc-75(ot1539[mScarlet-I3::unc-75]) I. Show Description
mScarlet-I3 tag inserted into endogenous unc-75 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534.
|
|
| OH19333 |
C. elegans |
aex-1(ot1543[aex-1::SL2::gfp::his-44]) I. Show Description
SL2::GFP::HIS-44 tag inserted into the endogenous aex-1 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19337 |
C. elegans |
tph-1(ot1545) II. Show Description
ot1545 is CRISPR-engineered 2,838 bp deletion removing the entire tph-1 coding region. Sequence after edit: tgtatattacgtgccgaattccagaagcaccacgcccaacacaaagacacgttttcctgcagaagaggaa. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19575 |
C. elegans |
otIs927 V. Show Description
otIs927 [ges-1p::nlp-40::tagRFP-T::SL2::GFP::his-44::tbb-2 3 UTR + inx-6(prom18)::tagRFP-T::unc-54 3' UTR] V. Transgene allows monitoring of the secretion of NLP-40 neuropeptide from the intestine under different physiological conditions. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19587 |
C. elegans |
php-3(syb1549[php-3::GFP]) III; otIs669 him-5(e1490) V. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. Reference: Fernandez RW, et al. Development. 2025 Aug 15;152(16):dev204958. doi: 10.1242/dev.204958. PMID: 40838983.
|
|
