Search Strains

T24H10.1 Homozygous. Outer Left Sequence: cggattattgacgcgtttct. Outer Right Sequence: tggcaaaactaccacgtgaa. Inner Left Sequence: cgcgtccacatcttttctct. Inner Right Sequence: gcaaaacttccagcgatttc. Inner Primer PCR Length: 1157. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y92H12BR.6 Homozygous. Outer Left Sequence: caccatgtgtatcccccttc. Outer Right Sequence: gcaccacgtgatcagagaaa. Inner Left Sequence: ttggattttctgtacgacgtg. Inner Right Sequence: aagaaaaacccccgaaaatc. Inner Primer PCR Length: 1197. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C10H11.10 Homozygous. Outer Left Sequence: gcggtgaaaccgtcattact. Outer Right Sequence: actccacatccatcgaaagg. Inner Left Sequence: cttcggcttatccaaatcca. Inner Right Sequence: caaactccctcctcgtgtgt. Inner Primer PCR Length: 1105. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

E01H11.3 Homozygous. Outer Left Sequence: ccgattgccaaaacgattac. Outer Right Sequence: agcccgcttccttcatagtt. Inner Left Sequence: tcatgaagctatcggaagatca. Inner Right Sequence: tcctccatcaccagacaaca. Inner Primer PCR Length: 1194. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H19N07.2 Homozygous. Outer Left Sequence: gaaagttcgcggactgaatc. Outer Right Sequence: cttgtcggtcattgtgtcgt. Inner Left Sequence: cgtgcattcgaagcttacac. Inner Right Sequence: cgaaaaatagaaggtcccct. Inner Primer PCR Length: 1180. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F41H10.6 Homozygous. Outer Left Sequence: ggggtgatttcgggtctaat. Outer Right Sequence: tccaacactcatcggattca. Inner Left Sequence: agtgaagtccgagacggaaa. Inner Right Sequence: agtatgcccaacacatccg. Inner Primer PCR Length: 1139. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W04H10.3 Homozygous. Outer Left Sequence: cacgtagcttcgggtcattt. Outer Right Sequence: aagaaatttgcattggagcg. Inner Left Sequence: agtctagcagatccacatggc. Inner Right Sequence: gtgacgccagcacattctta. Inner Primer PCR Length: 1246. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y51H1A.5 Homozygous. Outer Left Sequence: cgccgaaaatacggtatcac. Outer Right Sequence: tttcttctggaaaatgcgct. Inner Left Sequence: gggtctcgacacgaaaattg. Inner Right Sequence: gatcttgaatgcgtggtgtg. Inner Primer PCR Length: 1312. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F14H12.6 Homozygous. Outer Left Sequence: ggaaatgccaaggcagatta. Outer Right Sequence: tccaacacgaaaatgtgagc. Inner Left Sequence: tttccgtgttttaagataagaacaaa. Inner Right Sequence: ctaaccttctgcatcctcgc. Inner Primer PCR Length: 1196. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y32H12A.7 Homozygous. Outer Left Sequence: atattggagggaatcccgaa. Outer Right Sequence: aaaaatcaacgatgatgggc. Inner Left Sequence: cgttcgattttatttttagtaacca. Inner Right Sequence: tgttcaggtgagcaattttctg. Inner Primer PCR Length: 1307. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K10H10.2 Homozygous. Outer Left Sequence: ttactttcgaggttggaggc. Outer Right Sequence: tcgtttactcatctcgcacg. Inner Left Sequence: cccatgaaagccctacattt. Inner Right Sequence: cgctttttgttgaaaagttcg. Inner Primer PCR Length: 1235. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y39H10A.3 Homozygous. Outer Left Sequence: agcgagaaattcacgatgct. Outer Right Sequence: ttcaaatttttcgcagtgga. Inner Left Sequence: gtgtgctccgaacgaaaagt. Inner Right Sequence: cccgtttttcgggatttt. Inner Primer PCR Length: 1157. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F42H10.7 Homozygous. Outer Left Sequence: gctccttcagctgctctcat. Outer Right Sequence: aaattgagcgccaagttgtt. Inner Left Sequence: gtctctatatttggccgcga. Inner Right Sequence: cccgaggagaagtacattgc. Inner Primer PCR Length: 1232. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C15H11.2 Homozygous. Outer Left Sequence: tcgtttcgagaccgagtacc. Outer Right Sequence: caccatttggagtgacgttg. Inner Left Sequence: tgggtccaaaattgccagt. Inner Right Sequence: atctatgagcgaatcgtcgg. Inner Primer PCR Length: 1231. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F16H11.3. Homozygous. Outer Left Sequence: atcggcaaaggattcatcag. Outer Right Sequence: ttcttgtctggctgcctttt. Inner Left Sequence: tccattgtggctatgagctg. Inner Right Sequence: gatcgaacacctatgccgtt. Inner primer WT PCR product: 3216. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F55H12.1. Homozygous. Outer Left Sequence: CTCCCTACCACGCATTGTTT. Outer Right Sequence: CCACTCCGTCACCCACTACT. Inner Left Sequence: TTGAACGTGGACTTTTCGTG. Inner Right Sequence: TGATATTCGCTCGCAGTGAC. Inner primer WT PCR product: 3669. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T06H11.4. Received new stock 9/15/04. Homozygous. [NOTE: Seems to grow better at lower temperature (15C).] Outer Left Sequence: GGTCTGTTGCATGTGGTTTG. Outer Right Sequence: TTCGTCATCCCTCTTCATCC. Inner Left Sequence: TCTAAGCTGCAAACTCGCAA. Inner Right Sequence: AATCTGTTACCCTTGCTGCG. Inner primer WT PCR product: 3273. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R05H10.6. Homozygous. Outer Left Sequence: CCACCAAAGTGCACATCAAC. Outer Right Sequence: TGTCTTGCCTCATGTCTTGC. Inner Left Sequence: AGTTGACGATGGAGAATGGC. Inner Right Sequence: GTTCCATCCACGGTGTCTCT. Inner primer WT PCR product: 2740. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R01H10.7. Homozygous. Outer Left Sequence: AATTAACTGGCGACACCCTG. Outer Right Sequence: GCCAATAATTTCAGGGTCCA. Inner Left Sequence: TGATGAAACCACTTCGGACA. Inner Right Sequence: GCTCAGCTTCTGCAATTCCT. Inner primer WT PCR product: 2547. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C17H12. Homozygous. Outer Left Sequence: GAAATCCGCCTGAAAAATCA. Outer Right Sequence: GTGAAAACCAAGTGCAGGGT. Inner Left Sequence: AGCATTATCCCCGCATGTAG. Inner Right Sequence: AAACTGGGCGAGGGATTTAG. Inner primer WT PCR product: 2532. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C15H11.6. Homozygous. Outer Left Sequence: GCGGACGTACCATTCAAAGT. Outer Right Sequence: ACTGCAGCCTGAAAGTTCGT. Inner Left Sequence: GGCAGAAGTAAGGCTTGCAC. Inner Right Sequence: CATGGATTGACACACCTTGC. Inner primer WT PCR product: 3088. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C14H10.3. Homozygous. Outer Left Sequence: GCGAAAACTGAACACGGAAT. Outer Right Sequence: CCTTAACATGCGGCCATTAT. Inner Left Sequence: GAAAAGACGCACGAGGAAAG. Inner Right Sequence: ATTTCTGACGACTGGTTGGG. Inner primer WT PCR product: 3138. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F39H12.4. Homozygous. Outer Left Sequence: GTTTCGTCGACTTTGCATCA. Outer Right Sequence: GCACTACACCTTCCGAGAGC. Inner Left Sequence: CCGATAGGGTTGCTTGATGT. Inner Right Sequence: GGTGCAACCGAAAGTTTGTT. Inner primer WT PCR product: 2828. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R01H10.8. Homozygous. Outer Left Sequence: TGTGTTGAGCAGTGGAAAGG. Outer Right Sequence: TTGGCTGGCCATACTCAAAT. Inner Left Sequence: TATTTGGGCATGATTCGTGA. Inner Right Sequence: TTCGAACATAACCATCCGGT. Inner Primer WT PCR product: 3263. Deletion size: 2143 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F34H10.4. Homozygous. Outer Left Sequence: AGACAATTTCCGTCCGTCAC. Outer Right Sequence: CCCTCTTCTGAGTTTTCCCC. Inner Left Sequence: TTCTCCCCTTTTTGCATGTC. Inner Right Sequence: GTGTCTTTTGTTCCGACGGT. Inner Primer WT PCR product: 2628. Deletion size: 2095 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F26H11.5. Homozygous. Outer Left Sequence: AGCGATGGATTTCGATTGAC. Outer Right Sequence: AAGGCACATGCCTAAAATGC. Inner Left Sequence: CAATCGAGTTCATCCCAACC. Inner Right Sequence: TTCCCAAAATTTCTTCTGCG. Inner Primer WT PCR product: 2197. Deletion size: 615 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 4865 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttcactctgtccgcgtttctttgaccgcat ; Right flanking sequence: tagcctcgtaatgtagcagatacccaaaac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous sterile, Pvl. Deletion of 1266 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ Pvl, sterile adults (ve645 homozygotes) and non-GFP Unc animals (hIn1[unc-54(h1040)]) homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: cgcgtcaactggaattttctttttccccgg ; Right flanking sequence: ATCAATCTGGCTTGGAGCCAACGTAATGGT. sgRNA #1: aattgagcgtagaaattccg; sgRNA #2: CTCCAAGCCAGATTGATACc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous sterile. Deletion of 1965 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ sterile adults(ve673 homozygotes) and non-GFP Unc animals (hIn1[unc-54(h1040)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: ggaaTCACTTGGTCACTTGTGTAGTATCAC ; Right flanking sequence: aggaatatcacgaaaaaatgcgaaatttgg. sgRNA #1: GCATTTGAATGGAGCGGAGC; sgRNA #2: ccaaaaatgcaatttcagcc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 7049 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aacgcactggaaatttaatagttgtttgcg ; Right flanking sequence: ataaatgtattataaatatggacaatgttt. sgRNA #1: gtgaatccccacagagtact; sgRNA #2: gcacaataaattaagaagta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1604 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tcagATGTTTTCTTCACGTCATATTTTATC ; Right flanking sequence: GATTCTATTTTTGATGCTGACAAAGAAGTC. sgRNA #1: AAACGTTCGTCCAATAATAA; sgRNA #2: CACAACTTCTACAATAAACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3011 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATACATAAACTAATCCAGAAATTGATCCCA ; Right flanking sequence: AGGACATTTTTTCACTGCAAATCGCCGAAT. sgRNA #1: CAACTTAACTTCCAGATATG; sgRNA #2: TACACCAATAGCTCCATACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Late larval arrest. Deletion of 1316 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ clear arrested L4 larvae (ve801 homozygotes) and non-GFP Unc animals (hIn1[unc-54(h1040)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: CAAATAAATTTAACGCCTTCATTATCTCCA ; Right flanking sequence: CGGCctgaaaaatgcgtaattccctgaaaa. sgRNA #1: GCTCAATTGATGAATATCGG; sgRNA #2: TGACACCGTCGGTTGAGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1304 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gttggctagagtcaacccaacgctccgccc ; Right flanking sequence: CCGCGCCGTCCAGAATTGTAATACTTTCTT. sgRNA #1: tcgaaaagagggaggtgagt; sgRNA #2: AGAGTCGAACCACTGGAAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1234 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTAAGATGTATAATACAATGGTGTTGAAG ; Right flanking sequence: TAAATCGAGATTTTAATGAAATTATTACAT. R03H10.7 sgRNA #1: TTATGTTGGAATTTGACTGA; R03H10.7 sgRNA #2: CAGTTCTGCTATGTGCTGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

tmIs1245 Break points: dpy-9 kvs-5 IV. Covered region (Mb) (0.3..0.7) Balancer marked with myo-2p::Venus. Larval arrest. Deletion of 879 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ Venus+, and segregate wild-type GFP+Venus+, GFP+ arrested early larvae (ve979 homozygotes), and Venus+ dpy-9 (dpy-9(tm9713) kvs-5(tmIs1245) homozygotes). Pick WT bright GFP and check for correct segregation of progeny to maintain. [NOTE: ve979 deletion also removes K11H12.12 and K11H12.13, each of which encodes a snoRNA.] Left flanking Sequence: GAAAACTTTGGTGTTCTTTCTCTTCCAGTT; Right flanking sequence: TGGACGGCGCTCAACTGTCTGTAGTGCCAG. rpl-15 crRNA A: CTTGGCTTGGGATCCTCCGC; rpl-15 crRNA B: TGGTTGGGCGTGGGACACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. sdhb-1(tr438) is a C436T (H146Y) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-127. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.

Homozygous viable. sdhb-1(tr455) is a C436T (H146Y) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-127. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.

CRISPR/Cas9 engineered tagged endogenous locus.

Heterozygotes are WT. hIn1 homozygotes are Unc. tm759 homozygous arrest as early larva with incomplete penetrance (60% at 25C, 50% at 20C, 30% at 18C, and 50% at 15C). Viable tm759 homozygotes show various postembryonic phenotypes (Unc, Dpy, Egl, Mig, Muv).

Array name unknown. Maintain at 20-25C to select for transgenic animals.

gaIs259 [R09H10.3p::his-24::mCherry + unc-119(+)]. Published in Liu, X., et al., Cell, 2009. 139(6).

NeuroPAL landmark reporter in a sextuple CUT mutant background. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). otDf1 is a deletion affecting ceh-41, ceh-21, T26C11.9, and ceh-39. Reporter expression is affected in this mutant, suggesting alterations in neuronal identity.

sraEx281 [ttx-3p::chop-2(H134R)::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AIY and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is decreased upon symmetrical stimulation, and asymmetrical stimulation causes the worm to turn in the same direction the head was bent when AIY was excited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.

sraEx291 [npr-9p::chop-2(H134R)::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AIB and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is increased upon symmetrical stimulation. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.

sraEx301 [str-2p::chop-2(H134R)::TagRFP + str-2p::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AWC(on) and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is increased upon symmetrical stimulation, and asymmetrical stimulation causes the worm to turn in the opposite direction to which the head was bent when AWC(on) was excited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.

sraEx306 [ser-2(prom2)::chop-2(H134R)::TagRFP + ser-2(prom2)::mKO + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses mKO and TagRFP in AIY, AIZ and RME in the head, and has little response to blue light in the absence of ATR. In the presence of ATR asymmetrical stimulation of AIY causes the worm to turn in the same direction the head was bent when AIY was excited, whereas asymmetrical stimulation of AIZ or RME causes the worm to turn in the opposite direction to which the head was bent when AIZ or RME was excited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.

sraEx329 [odr-2(prom18)p::chop-2(H134R)::TagRFP + odr-2(18)p::mKO + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses mKO and TagRFP in SMB in the head, and has little response to blue light in the absence of ATR. In the presence of ATR asymmetrical stimulation of SMB causes the worm to turn in the same direction the head was bent when SMB was excited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.

sraIs49 contains [nmr-1p::G-CaMP + unc-119(+)]. sraEx80 contains [sra-6p::chop-2(H134R)::mCherry + osm-10p::G-CaMP + unc-122p::mCherry]. Superficially wild-type. Maintain by picking red fluorescent worms.

sraIs49 contains [nmr-1p::G-CaMP + unc-119(+)]. sraEx83 contains [tdc-1p::chop-2(H134R)::mCherry + F55B11.3p::mCherry]. Superficially wild-type. Maintain by picking red fluorescent worms.