Search Strains

wdIs51 [F49H12.4::GFP + unc-119(+)]; likely integrated in X. hrtEx53 [des-2p::mKate::GS1(low) + unc-119(+) + myo-2p::tdTomato]. Pick tdTomato+ animals to maintain. PVD development is somewhat affected by moderate levels of actin-perturbing DeAct-GS1 expression in PVD and FLP. Phenotype is less severe than that of the high DeAct-GS1 expressing strain STR198 and DeAct-SpvB expressing strain STR200. Reference: Harterink M, et al. J Cell Sci. 2018 Oct 22;131(20):jcs223107. PMID: 30254025.

Heterozygotes are WT with GFP in pharynx. Segregate Dpy and GFP+. mig-5 homozygotes are non-GFP and show a weakly penetrant gonad defect and a fully penetrant QL.d migration defect.

flvIs17 [tag-168::NLS::GCaMP7F + gcy-28.d::NLS::tagRFPt + ceh-36::NLS::tagRFPt + inx-1::tagRFPt + mod-1::tagRFPt + tph-1(short)::NLS::tagRFPt + gcy-5::NLS-;:tagRFPt + gcy-7::NLS::tagRFPt]. See description of strain OH15263 for full description of otIs670 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). This strain can be used for pan-neuronal calcium imaging. Back-crossed 5x to MT21793 after transgene integration. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

Unc. ts Dpy.

let-99(dd17) contains a 647bp deletion with the flanking sequences aatttttaggaagtttccagaaatttttcc / CAAGGCTCCCACGAAGATTATCGCGATCTA. The deletion removes the N terminus of the open reading frame including the start codon and the DEP domain. Heterozygotes are GFP+ in the pharynx. dd17 is a maternal effect lethal mutation.

let-99(dd18) contains a 1039bp deletion with the flanking sequences TTTGGATGAGTTGAAGCATCCCAAGCCCCG / ATGAATGCTCTCTTATTGTTAATCTCCTCT. The deletion starts behind the DEP domain. Heterozygotes are GFP+ in the pharynx. dd18 is a maternal effect lethal mutation.

ddIs97 [F47G4.6::2xTY1::GFP:: FRT::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

ddIs101 [hmg-11::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

ddIs105 [sir-2.2::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

ddIs106 [hmg-3::2xTY1::GFP:: FRT::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

ddIs111 [glh-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

ddIs115 [R07E5.3::TY1::EGFP::3xFLAG(92C12) + Cbr-unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

zdIs5 [mec-4p::GFP + lin-15(+)] I. cy14 was isolated in a screen for suppressors of the AVM axon ventral guidance defect of slt-1 null mutant. cy14 is a G-to-A transition in the splice acceptor of intron 5 of clr-1 that leads to the use of a cryptic splice acceptor and consequently to an 18 bp deletion in exon 6.

tmIs905 [dat-1p::alpha-synuclein(A30P) + ges-1p::DsRed] II. egIs1 [dat-1p::GFP]; reportedly maps to LG IV. hrpr-1 also known as hrp-2. yyz8 is a weak loss-of-function allele. Neurodegeneration in ADE neurons. Neurites are shorter in PDE neurons.

C10H11.8. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1413 homozygotes (arrest stage/phenotype undetermined). Homozygous ok1413 males are segregated, but homozygous ok1413 hermaphrodites have not been isolated. Pick WT and check for correct segregation of progeny to maintain. External left primer: GGCAGCTGGGATTTATTCAG. External right primer: GCGTGGAGAAACAAAATGGT. Internal left primer: GAATCAGTCGTGGGCATTTT. Internal right primer: ATTCGCGTTTTGCTTGAAAT. Internal WT amplicon: 2524 bp. Deletion size: 770 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y66H1A. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C15H11.7, C15H11.8. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1531 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R01H10.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F35H10.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1588 homozygotes (arrest stage/phenotype undetermined). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T24H10.7. External left primer: GATCGAGGAAATTCGGCATA. External right primer: CGTCACCATGTGAGGAAATG. Internal left primer: CATGCGCATTCCTTCTATCA. Internal right primer: TCAAACCATAACGGCATTCA. Internal WT amplicon: 2262 bp. Deletion size: 1430 bp. Deletion left flank: GGAGAGAGGCTTAGACATTTACACATGTGA. Deletion right flank: CAGGGTAGATTGTATTGTTTCGTTTTTTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F53H10.2. External left primer: GCACTTTCTAGGCGGAACTG. External right primer: GTGTATGAATGGTCGGGGTC. Internal left primer: CTGAAGTGGTGGAGGTGTCA. Internal right primer: TCCTGTTGTTGGTTGAGTCG. Internal WT amplicon: 1685 bp. Deletion size: 1280 bp. Deletion left flank: TATTTTATAGGAAACACTATGTTTATTAAT. Deletion right flank: TAAGTTCAGTGTGGCAGAGTAGTCTCCAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T24H10.7. Superficially wild type. External left primer: GATCGAGGAAATTCGGCATA. External right primer: CGTCACCATGTGAGGAAATG. Internal left primer: CATGCGCATTCCTTCTATCA. Internal right primer: TCAAACCATAACGGCATTCA. Internal WT amplicon: 2262 bp. Deletion size: 1168 bp. Deletion left flank: CATTAGCCGACGATTTTTGTGACTAACTGC. Deletion right flank: ATTTTTTTAGCATTCAATTCAAATTCAATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H19N07.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1668 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Outer Left Sequence: GGTCTTGAACGGGAGCATAA. Outer Right Sequence: ACCTTCGATGATCGGATTGA. Inner Left Sequence: ACGGTTTGGTTTTGAACTGC. Inner Right Sequence: TCAAGAATTGGCGTGAAGTG. Inner Primer WT PCR Product: 2552. Deletion size: 826 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

E01H11.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H12C20.6. Superficially wild type. External left primer: TTCTCCCGAGACACTTGCTT. External right primer: GAAGTAGCTTTTTGGGTGCG. Internal left primer: ACCACTTGTGACACTCGCAC. Internal right primer: ATCAGCGATCCAAACAGCTT. Internal WT amplicon: 1824 bp. Deletion size: 624 bp. Deletion left flank: ATATGCTCAAAAAGCATTTGAAACATATTG. Deletion right flank: TATTCAATCTTAAAACCATAAAAATTTTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R01H10.6. Superficially wild type. External left primer: ACTTCGGTAAATCGACACCG. External right primer: TGTCCGAAGTGGTTTCATCA. Internal left primer: TTCGAGACGGTAAATCAGCC. Internal right primer: GAACCTACTCGCAGGGTGTC. Internal WT amplicon: 1513 bp. Deletion size: 692 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K01H12.2. External left primer: TCCGTGATATGTTGTTCCGA. External right primer: TCACCTCGATTCCACATGAA. Internal left primer: TGACTATGTGACGAAACGGC. Internal right primer: CGTTGCGGAATTCTTTGATT. Internal WT amplicon: 1650 bp. Deletion size: 533 bp. Deletion left flank: TAAGCGGCACGGTAGATGATGATACCTTGT. Deletion right flank: GTTCCTCCCGAGGCGAGATCAATCAAGAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K01H12.2. External left primer: TCCGTGATATGTTGTTCCGA. External right primer: TCACCTCGATTCCACATGAA. Internal left primer: TGACTATGTGACGAAACGGC. Internal right primer: CGTTGCGGAATTCTTTGATT. Internal WT amplicon: 1650 bp. Deletion size: 528 bp. Deletion left flank: CCATCTTGGCAGTGTCGAACATTCCGAAGT. Deletion right flank: CGGAGCCACAGCAGTCTTGGAGACAGCGGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K09H11.3. Superficially wild type. External left primer: TTTAAGATTCGCCAGCCTGT. External right primer: GACCTCAGCGCATTTGTGTA. Internal left primer: GTCGTTACATCCTCGTCGGT. Internal right primer: TTCCTCGATGCTCTTCGTTT. Internal WT amplicon: 3077 bp. Deletion size: 1648 bp. Deletion left flank: TACGACTGGACACACTGCCGAGCCATCCAA. Deletion right flank: TGCCAAAGAAAATGAACCGATCGGGAATCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T19H12.8. External left primer: CCTGGATTCGATTTTCGGTA. External right primer: GGCATCAGAAATGCTCCAAT. Internal left primer: AATAATGGCATCGGTTCTGG. Internal right primer: TCCAACCAAATGAGAGTCCC. Internal WT amplicon: 2272 bp. Deletion size: 754 bp. Deletion left flank: TTTTTGTCTCATCGTCAGAATTTCGAAATG. Deletion right flank: TTATATAATTTTTTTTATTGCAAAAATTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T24H10.6, T24H10.3. Homozygous viable deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1931 homozygotes (Sma, Unc, Gro with tail and vulval defects). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGGCGATTATGGAAGAGGAG. External right primer: ATTGCGATGAGAAAGCTCGT. Internal left primer: ATTCTCGCAAAGGCGACTAA. Internal right primer: CAAGCGTAAGGCTGAGAAGG. Internal WT amplicon: 2301 bp. Deletion size: 1608 bp. Deletion left flank: AGTTAGTAGGAACCAAGTTTGGCGAATACG. Deletion right flank: AAAACTTATAAATAAAGTGACAGATTTTAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F15H10.3, F15H10.4. Superficially wild type, with small broods of viable progeny and lots of unfertilized oocytes. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H14A12.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+ (heterozygotes), arrested hT2 aneuploids, and non-GFP ok1998 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. External left primer: ACTTGTGCGGGAGAAGAGAA. External right primer: CGAATTAAGCTTTCAAGGCG. Internal left primer: GAACCATGCCGAGTTTGATT. Internal right primer: TGAACATTTGGGGACATTGA. Internal WT amplicon: 2152 bp. Deletion size: 1351 bp. Deletion left flank: ACTTTCGGAGAGCTCGAGGTTCCAGCCGAC. Deletion right flank: TGCTCACAAGAACGGCACCACCCTTGTCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T19H12.8. External left primer: CCTGGATTCGATTTTCGGTA. External right primer: GGCATCAGAAATGCTCCAAT. Internal left primer: AATAATGGCATCGGTTCTGG. Internal right primer: TCCAACCAAATGAGAGTCCC. Internal WT amplicon: 2272 bp. Deletion size: 672 bp. Deletion left flank: CCATTGGGGAAATTGCTTCAAACCCCGCAT. Deletion right flank: TTGTATTTTTTTCTCAAAGGTCTATAATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H12C20.3. External left primer: CGGTTCTAATCCTCCGTCAA. External right primer: AGCGCACCTGTAAATTGCTT. Internal left primer: TGCCTTGTTTGCCAAGATTT. Internal right primer: CTCCAACCCGTCCTTCTGTA. Internal WT amplicon: 1761 bp. Deletion size: 1301 bp. Deletion left flank: TTATATCATGTTTAGCCCACAAATATTCTA. Deletion right flank: TTTCCGGATGGAACATATTATGATAGAACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H12C20.3. External left primer: CGGTTCTAATCCTCCGTCAA. External right primer: AGCGCACCTGTAAATTGCTT. Internal left primer: TGCCTTGTTTGCCAAGATTT. Internal right primer: CTCCAACCCGTCCTTCTGTA. Internal WT amplicon: 1761 bp. Deletion size: 726 bp. Deletion left flank: ACAAAATTTAACCGATTTCAAAAATTATAA. Deletion right flank: TTGAACTCTATCGTATTCTGGGCGGTACTT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F20H11.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2058 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAATCGTATTGCTGCTTCCA. External right primer: CGGAGCTGGTGTAGGAAAAG. Internal left primer: GTCCATTCGAATCTTTCCGA. Internal right primer: TGCTGAACGTGATCTTCGAG. Internal WT amplicon: 3229 bp. Deletion size: 1540 bp. Deletion left flank: CACAGATTCTAGATGAAGTGATAAAATCCG. Deletion right flank: TTTTGAAGTTCTAAGACCATTCGTCCAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54H12.6, F54H12.5. Superficially wild type. External left primer: TTGGATGGTCTTCTTCTGGG. External right primer: CGAAAATGAATGGGAGGAGA. Internal left primer: TGGAGTGGAAATTTCTTCCG. Internal right primer: CATGGGGTTTCGACAGACTT. Internal WT amplicon: 2179 bp. Deletion size: 1993 bp. Deletion left flank: AACCACGGTAACGGTCTCGACACGACAAGT. Deletion right flank: CTTTTCAGGAGTGAAACACGAAGGAATGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F13H10.4. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2135 homozygotes (sterile, oftein with abnormal vulva). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGCATGGACTTGAGGATTGG. External right primer: AATGGTGCCATCTATCAGGC. Internal left primer: TGAGCATCATTGGGAACAAA. Internal right primer: ATAACTCAAAAAGCGCCGAA. Internal WT amplicon: 3344 bp. Deletion size: 1311 bp. Deletion left flank: TTGTATCTGTAATAAAATCGAAAAAGTAAT. Deletion right flank: GAGCATTACAGAATGAGAAGTTTGAAGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y53H1A.2. External left primer: ACACGAAACCTAGTCCACGG. External right primer: ATTCGCATAAAAATGGGCAA. Internal left primer: TGTAGAAACCCATTCGAGGG. Internal right primer: TGAATAAGGCCACTGGGAAA. Internal WT amplicon: 1710 bp. Deletion size: 609 bp. Deletion left flank: TCACCGAAAAATCAATATTCGCCCCCGCAA. Deletion right flank: ACCAAAAAACTGATTTTTCTGCAATTTTTT. Insertion Sequence: AGCCTCACCCAAAACATTTTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3023) in T24H10.1, detectable by PCR using the following primers. External left primer: GCACAGAAGGGTAGCTGGAG. External right primer: TTGGCTTCTGGCGTCTACTT. Internal left primer: ATGCGATAAATGGAGATGGC. Internal right primer: ACACGCGGTTATTAAGGTCG. Internal WT amplicon: 2047 bp. Deletion size: 568 bp. Deletion left flank: ATTAATACTCTCCGTCATTCTTTACCTTTT. Deletion right flank: AAATCTGCACAACTTCTACTTTCGGCACTT. Insertion Sequence: CATCTGCACA. Validation: gk3023 passed by CGH. Other deletions (gk3142, gkDf25) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F39H11.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2247 homozygotes (mid- to late-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GACTTCGTCGTGAGCATTCA. External right primer: ATTCTTAACCGTGCGACACC. Internal left primer: CATCATAAAGCATGTGCGCT. Internal right primer: TGTCGCTGCTCAGAAGAAGA. Internal WT amplicon: 2222 bp. Deletion size: approximately 400 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H12C20.2. External left primer: ATTCGGCTCGATCAGGTAAA. External right primer: TGAAAGAAAACGTGTGCGAG. Internal left primer: GGTTGATCTAGCTTCGCCAG. Internal right primer: GAACATGTCGAATGAGGCAA. Internal WT amplicon: 2942 bp. Deletion size: 2158 bp. Deletion left flank: CATCTGATTAGGATATTGTGATACCACTGC. Deletion right flank: TAGCAGCAGATTGACGGCAAATGATATTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H14N18.4. External left primer: TTCCGAGTCTGGCTGAAACT. External right primer: GGCGGATTTGTCATGACTCT. Internal left primer: AAATTGTCGCGTTGCTTACC. Internal right primer: TGCGTAAGATATTTTCTCATAACTG. Internal WT amplicon: 1211 bp. Deletion size: 844 bp. Deletion left flank: TTAGAAAATTATTTTGAAAAGTGTTAAATT. Deletion right flank: GTTTCACGAGCATTTATAGTTTGACACATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C09H10.7. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2381 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CAAATTTCCAGGTTCGTCGT. External right primer: TTCCTGTTCGAAACGAGGTT. Internal left primer: GTGGATGCTCCAACTGACAA. Internal right primer: TGACGATTTGAATGTCTGATACAA. Internal WT amplicon: 1330 bp. Deletion size: 456 bp. Deletion left flank: TTCAAAATGGAGTTTGATATCAAAAAAGTG. Deletion right flank: ATCAGAAGGAGAAGACGCATCGGATTTATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H19M22.3. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2827 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AATCCGTGACGCTTAAATGG. External right primer: ATAATTCAGTGCCCGAGAGC. Internal left primer: ATCTCCGACTACACCAGCGA. Internal right primer: AGCGTCCGTTGACTTGAGTT. Internal WT amplicon: 1135 bp. Deletion size: 538 bp. Deletion left flank: AGAAAAAAATCTAGCAGATTGCAAAATCTA. Deletion right flank: AGTGTGCAGTGAGCAGCTGCTGCGACAAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T16H12.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2764 homozygotes (late larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACTCGCTCGATTTGTTCGTT. External right primer: TCGAGGAGCCTTTTCACATT. Internal left primer: GACGCAAATTCGAGAAGATTT. Internal right primer: TGACACTGTCGAATAAGGCG. Internal WT amplicon: 1149 bp. Deletion size: 613 bp. Deletion left flank: TCGTTCGACGCAAATTCGAGAAGATTTTGT. Deletion right flank: TTCGAAACTTTATCGAGAGAAACATTGAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H16O14.1. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3074 homozygotes (sterile with no eggs, often with vulval blip). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGACGGCCAGATTCAGTAAA. External right primer: CGTAATGGCGGTTTTTGATT. Internal left primer: TTTGGTAACTTCTGGCCGTC. Internal right primer: GGGGCTTGTTTGAAAGAACA. Internal WT amplicon: 1227 bp. Deletion size: 582 bp. Deletion left flank: CAAACTAAGTATTTATTCTTTTAACATTTT. Deletion right flank: AGTAATTCTTTTTGGATGTTTCATGTCAAC. Insertion Sequence: TAAAAAGTATTTATTCTTTTAACATTCTTTTAACAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F21H12.4. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3196 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGACTGCGAACATTGGGTAG. External right primer: CATACCGGGAGTCTGCTTTC. Internal left primer: CAAGACCGAGTGTCGACTGA. Internal right primer: TGGCCAGAAGTGATGTCTGA. Internal WT amplicon: 1140 bp. Deletion size: approximately 600 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y32H12A.5. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3136 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGGAGAACGCGAAAACAAGA. External right primer: CAGGACATCGTCCTCCACTT. Internal left primer: GGAACGAAAAGGGGGAATAA. Internal right primer: CGTTCAGTAGCTGCTTCAAGA. Internal WT amplicon: 1358 bp. Deletion size: 299 bp. Deletion left flank: AAAAGCGGCGAGCACGACAAATGTGTGAAA. Deletion right flank: TATACATGGCTCCCATCATAATCATCAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807