| GE3633 |
C. elegans |
unc-32(e189) cyk-4(t1689)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.
|
|
| GE4132 |
C. elegans |
unc-32(e189) com-1(t1626)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles, and Uncs which are Mel with over 99% embryonic lethality.
|
|
| HR16 |
C. elegans |
mel-23(ct45)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT and DpySteriles. ct45 homozygotes give only dead eggs at all temperatures. ct45 is ts dominant. Hets give more viable progeny at 15C than 25C.
|
|
| HY463 |
C. elegans |
unc-32(e189) pod-1(ye11)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Sterile Dpys and Uncs. Unc worms produce only dead embyros due to strict maternal effect pod-1(ye11) mutation. Embryos from pod-1 homozygous hermaphrodites are osmotically sensitive and exhibit polarity defects.
|
|
| HZ111 |
C. elegans |
muIs16 II; sor-1(bp_1)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-5(e1490) V. Show Description
muIs16 [mab-5::GFP]. Larval lethal at L3/L4 stage. Ectopic expression of GFP in the arrested sor-1 mutant homozygotes (L3 stage). NOTE: This allele is published as bp1, but has been curated in WormBase as bp_1 in order to differentiate it from the STS marker bP1.
|
|
| HZ112 |
C. elegans |
muIs16 II; sor-1(bp3)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-5(e1490) V. Show Description
muIs16 [mab-5::GFP]. Larval lethal at L3/L4 stage. Ectopic expression of GFP in the arrested sor-1 mutant homozygotes (L3 stage).
|
|
| IP1001 |
C. elegans |
nhr-6(lg6001)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Homozygous nhr-6(lg6001) mutants have defective spermatheca development causing low brood size, abnormally shaped eggs, and occasional Egl. Heterozygotes are WT and segregate WT, semi-sterile WT, and Sterile Dpys.
|
|
| JH2691 |
C. elegans |
npp-10(ok467)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. ok467 deletion balanced by glp-1- and dpy-19-marked recombination suppressor. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. Heterozygotes are Rollers and GFP+ in the distal tip cell, and segregate WT Rol, lethal qC1 homozygotes, and npp-10 homozygotes (Emb or early Larval lethal). Pick WT GFP+ Rol and check for correct segregation of progeny to maintain.
|
|
| JH2756 |
C. elegans |
ect-2(ax751) II; par-3(it71) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III; zuIs45 V. Show Description
zuIs45 [nmy-2::NMY-2::GFP + unc-119(+)] V. Temperature-sensitive. Maternal-effect lethal at 25 C. Maintain at 15-20 C. Segregates Unc Mel, non-Unc Mel, non-Unc Ste. Reference: Zonies S, et al. Development. 2010 May;137(10):1669-77.
|
|
| JJ532 |
C. elegans |
pie-1(zu154) unc-25(e156)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Unc and DpySteriles. Uncs give only dead eggs. Maintain by picking WT.
|
|
| JK1122 |
C. elegans |
dpy-17(e164) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and DpySteriles. Do not distribute this strain; other labs should request it from the CGC.
|
|
| JK1438 |
C. elegans |
daf-2(m65)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, non-conditional dauers, and Sterile Dpys. Do not distribute this strain; other labs should request it directly from the CGC.
|
|
| JK2533 |
C. elegans |
qC1 [dpy-19(e1259) glp-1(q339) qIs26] III/eT1 (III;V). Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Throws heterozygous Rollers and Unc eT1 homozygotes. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. The distal tip cells are GFP+. It was an integration of qEx233. Do not distribute this strain; other labs should request it directly from the CGC.
|
|
| JK6403 |
C. elegans |
mpk-1(q1147[V5::mpk-1B] q1201[mpk-1B del] q1183[mpk-1AB::2xOLLAS])/qC1 [qIs56] III. Show Description
qIs56 [lag-2p::GFP + unc-119(+)]. q1201 is a 125 bp deletion causing a frameshift in mpk-1B without affected mpk-1A. Heterozygous animals Roll and have GFP+ distal tip cells. Segregates roller GFP(+) heterozygotes and non-roller GFP(-) mpk-1 homozygotes (sterile, but form a vulva). qC1 [dpy-19(e1259) glp-1(q339) qIs26] homozygotes are not viable. Endogenous mpk-1 locus tagged with a single V5 tag inserted into the mpk-1b-specific exon to specifically label the N-terminus of the MPK-1B protein, and two tandem OLLAS tags inserted into the C-terminus, labeling both MPK-1A and MPK-1B isoforms. Reference: Robinson-Thiewes et al. Cell Reports, In Press.
|
|
| JK6432 |
C. elegans |
mpk-1(q1190)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
Heterozygous animals Roll and have GFP(+) distal tip cells. Segregates roller GFP(+) heterozygotes and non-roller GFP(-) mpk-1 homozygotes which are sterile and vulvaless. qC1 [dpy-19(e1259) glp-1(q339) qIs26] homozygotes are not viable. q1190 is a deletion in mpk-1 that removes 2221bp between axons 2-7 (based on mpk-1b annotation). Sequence is shared between mpk-1a and mpk-1b. The deletion is in frame and leaves 27bp of coding sequence.Reference: Robinson-Thiewes S, et al. Cell Rep. 2021 May 25;35(8):109162. doi: 10.1016/j.celrep.2021.109162.
|
|
| JN213 |
C. elegans |
iff-1(tm483)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate sterile iff-1 homozygotes and Dumpy sterile qC1 homozygotes. Maintain by picking non-Dpy fertile heterozygotes. tm483 is a UV/TMP-induced iff-1 deletion allele generated by K. Gengyo-Ando and S. Mitani.
|
|
| JN218 |
C. elegans |
asb-1(tm498)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygotes are Rollers and GFP+ in the distal tip cell. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. asb-1(tm498) is homozygous sterile.
|
|
| JN219 |
C. elegans |
asb-1(tm499)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygotes are Rollers and GFP+ in the distal tip cell. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. asb-1(tm499) is homozygous sterile.
|
|
| JR423 |
C. elegans |
rhDf1/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and dead eggs.
|
|
| KIR1 |
C. elegans |
smc-4(tm1868) III/qC1 [dpy-19(e1259) glp-1(q339) qIs26] (III). Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Rollers. Homozygous sterile deletion allele tm1868 balanced by qC1 with rol and GFP markers. Segregates GFP + Roller heterozygotes, and non-rol non-GFP tm1868 homozygotes (sick, sterile, unc). qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. Pick Rol GFP+ and check for correct segregation of progeny to maintain. Reference: Csankovszki G, et al., Curr Biol. 2009 Jan 13;19(1):9-19.
|
|
| KK571 |
C. elegans |
lon-1(e185) par-3(it71)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles, and Lon which give only dead eggs.
|
|
| KW2088 |
C. elegans |
cdk-12(tm3846)/qC1 [dpy-19(e1259) glp-1(q339)] nIs281 III. Show Description
nIs281 [myo-2::RFP] integrated near qC1. Recombination between nIs281 and qC1 has been reported. Fails to complemement all markers on qC1. Heterozygotes are WT RFP+ and segregate WT RFP+, Dpy Sterile RFP+ , and tm3846 homozygotes (Emb). Reference: Bowman EA, et al. Development. (In Press).
|
|
| KW2211 |
C. elegans |
ckSi26 I; cdk-12(ok3664)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. ckSi26 [cdk-12::GFP::pal-1 3'UTR + unc-119(+)] I. GFP is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Throws heterozygous Rollers, tm3846 homozygotes (Emb), and tm3846 homozygotes (arrest as L1-L2 larvae). qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. The distal tip cells are GFP+. qIs26 is an integration of qEx233. Reference: Bowman EA, et al. Development. (In Press).
|
|
| LB128 |
C. elegans |
atp-2(ua2) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy(ts) Steriles and Uncs which arrest in the L3 larval stage. ua2 is a deletion of the first 2 exons of atp-2. atp-2 gene encodes for active site subunit of Complex V of mitochondrial respiratory chain, the ATP synthase.
|
|
| ML1150 |
C. elegans |
mlc-4(or253)/qC1 [dpy-19(e1259) glp-1(q339)] III; mcEx401. Show Description
mcEx401 [mlc-4p::GFP::mlc-4(WT) + pie-1p::GFP::mlc-4(WT) + rol-6(su1006)]. Rollers. Apparent homozygous lethal deletion chromosome balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT Rol, and segregate WT Rol, sterile Dpy (qC1 homozygotes), late embryonic - early larval lethal (mlc-4 homozygotes) and Sterile Rollers. Pick WT Rol and check for correct segregation of progeny to maintain. Reference: Gally C et al. Development. 2009 Sep;136(18):3109-19.
|
|
| ML1151 |
C. elegans |
mlc-4(or253)/qC1 [dpy-19(e1259) glp-1(q339)] III; mcEx402. Show Description
mcEx402 [mlc-4p::GFP::mlc-4(DD) + pie-1p::GFP::mlc-4(WT) + rol-6(su1006)]. Rollers. Apparent homozygous lethal deletion chromosome balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT Rol, and segregate WT Rol, sterile Dpy (qC1 homozygotes), late embryonic - early larval lethal (mlc-4 homozygotes) and Sterile Rollers. Pick WT Rol and check for correct segregation of progeny to maintain. Reference: Gally C et al. Development. 2009 Sep;136(18):3109-19.
|
|
| MLC218 |
C. elegans |
tbx-37(zu467) dpy-18(e364) tbx-38(zu460)/qC1[dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygote animals show roller phenotype and express GFP in the distal tip cells. Segregate roller and GFP(+) heterozygotes, embryonic lethal qC1 homozygotes and embryonic lethal tbx-37/38 homozygotes. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421
|
|
| MLC270 |
C. elegans |
tbx-37(tm314) tbx-38(tm581)/qC1[dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygote animals show roller phenotype and express GFP in the distal tip cells. Segregate roller and GFP(+) heterozygotes, embryonic lethal qC1 homozygotes and embryonic lethal tbx-37/38 homozygotes. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421
|
|
| MT11757 |
C. elegans |
ced-9(n3400)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT. Segregates Dpy Steriles.
|
|
| MT14615 |
C. elegans |
set-16(n4526)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
T12D8.1 deletion. Putative HMTase-encoding gene, from F21E9 (2001 library). Heterozygotes are WT, and segregate Dpy Steriles (qC1 homozygotes) and larval lethals (set-16 homozygotes).
|
|
| MT20108 |
C. elegans |
dpy-17(e164) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] nIs281 III. Show Description
nIs281 [myo-2::RFP] integrated near qC1. Recombination between nIs281 and qC1 has been reported. Fails to complemement all markers on qC1. Heterozygotes are WT. Segregates Dpy Sterile and Dpy Unc.
|
|
| MT20109 |
C. elegans |
dpy-17(e164) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Show Description
Heterozygotes are WT GFP+. Segregates GFP+ Dpy Sterile and non-GFP Dpy Unc. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1.
|
|
| MT5332 |
C. elegans |
lin-9(n942)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and Steriles. n942 homozygotes are sterile.
|
|
| MT5335 |
C. elegans |
lin-9(n943)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and Steriles. n943 homozygotes are sterile.
|
|
| MT5523 |
C. elegans |
unc-69(e587) ced-9(n1950n2161)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Uncs and DpySte. n2161 is an intragenic revertant of ced-9(n1950). The unc-69 ced-9 homozygotes have a maternal effect lethal phenotype: their offspring arrest as embryos or L1; they also give very few eggs at 25C.
|
|
| MT7554 |
C. elegans |
sqv-3(n2842) unc-69(e587)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and Sqv Uncs. n2842: mid-L4 vulva abnormal, sterile.
|
|
| MT7686 |
C. elegans |
ced-9(n2812)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT. Segregates Dpy Steriles.
|
|
| MT9454 |
C. elegans |
cup-5(n3194) unc-36(e251)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Sterile Dpys, and Mel Uncs. cup-5(n3194) is a Q139 ochre allele with a maternal effect lethal phenotype including accumulation of refractile bodies resembling apoptotic cells in some regards. cup-5 homozygotes are also defective in coelomocyte uptake.
|
|
| NA649 |
C. elegans |
feh-1(gb561)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, DpySteriles, dead eggs, and arrested L1 larvae (feh-1 homozygotes). feh-1 corresponds with some modification to Y54F10AM.2. feh-1(gb561) is a double deletion within feh-1 and is a null mutation.
|
|
| NG2324 |
C. elegans |
ina-1(gm86)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Sterile Dpys (e1259 is ts) and L1-L2 lethals which have an abnormal head (often notched) and are Ham.
|
|
| NG2618 |
C. elegans |
yDf10 unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and dead eggs. Derived from strain TY1353. Grows fairly slowly but seems more stable than TY1353, which gives lots of steriles.
|
|
| NG58 |
C. elegans |
ceh-10(gm58)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Sterile Dpys and Clear lethals (die as L1-L2s). Differentiation of AIY, CAN defective.
|
|
| PFR510 |
C. elegans |
set-2(bn129)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
Maintain at 20C or cooler. qIs26 [lag-2::GFP + rol-6(su1006)]. set-2 mutation balanced by glp-1- and dpy-19-marked recombination suppressor. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. Heterozygotes are Rollers and GFP+ in the distal tip cell, and segregate WT Rol, lethal qC1 homozygotes, and set-2(bn129) homozygotes (Mrt phenotype at 25C -- viable but homozygotes will become sterile in successive generations). Pick WT GFP+ Rol and check for correct segregation of progeny to maintain. set-2(bn129) homozygotes are short-lived on OP50. bn129 is a deletion removing 748 bp from exon 11 of SET-2L and from exon 3 of SET-2S resulting in a frameshift after 885 aa of SET-2L and after 117 aa of SET-2S with a premature stop four codons later. References: Robert VJ, et al. Front Cell Dev Biol. Dec 2020 Sep 22:8:561791.
doi: 10.3389/fcell.2020.561791. PMID: 33072747. Xiao Y, et al. Proc Natl Acad Sci USA. 2011 May 17;108(20):8305-10. doi: 10.1073/pnas.1019290108. PMID: 21527717.
|
|
| PHX2171 |
C. elegans |
set-2(syb2085)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
Maintain at 20C or cooler. qIs26 [lag-2::GFP + rol-6(su1006)]. set-2 mutation balanced by glp-1- and dpy-19-marked recombination suppressor. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. Heterozygotes are Rollers and GFP+ in the distal tip cell, and segregate WT Rol, lethal qC1 homozygotes, and set-2(syb2085) homozygotes (Mrt phenotype at 25C -- viable but homozygotes will become sterile in successive generations). Pick WT GFP+ Rol and check for correct segregation of progeny to maintain. set-2(syb2085) mutant animals that express a catalytically inactive form of SET-2, the C. elegans SET1 homolog. set-2(syb2085) homozygotes are not long-lived on OP50. Reference: Caron M, et al. Life Sci Alliance. Dec 2021, 5 (3) e202101140; DOI: 10.26508/lsa.202101140. PMID: 34893559.
|
|
| RG3161 |
C. elegans |
Y53G8AR.6(ve661[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26]III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Homozygotes are unhealthy. Deletion of 1671 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) unhealthy animals (ve661 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: aaaaatccgctagaaaccgtctaaaaacct ; Right flanking sequence: AGGCTTCACGTGCTGAAAGATTCGGAATTA. sgRNA #1: atcaatagcgtaggctttac; sgRNA #2: ACTAACATCAAATGACGCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3438 |
C. elegans |
let-767(ve938[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)] III. Larval lethal. Deletion of 1104 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) early larval lethal (ve938 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: ATCCATGAGCTCGAGTTGAAGTTGATGCGT; Right flanking sequence: TGGAATTTACAGAATTTCAATGGAAATAAC. let-767 sgRNA A: GATGTATCCGGTGGTGTCTG; let-767nsgRNA B: CACTGGCAAGCCATGTTACC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3440 |
C. elegans |
rnp-7(ve940[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)] III. Maintain by picking GFP+ Rollers (GFP expression in both pharynx and distal tip cells). Heterozygotes are Rol GFP+ (GFP expression in both pharynx and distal tip cells), and segregate Rol GFP+ (GFP expression in both pharynx and distal tip cells), non-Rol GFP+ (GFP only in pharynx) ve940 homozygotes (Unc, arrest as larvae with a curled tail). qC1[qIs26] is homozygous lethal (unknown stage). Deletion of 1847 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCGCTTCGATATCCACCACCGGATCCTCCA; Right flanking sequence: TGGAAGATATTGCACTGGTGGTCGTGCTTC. rnp-7 sgRNA A: GGAAGCCGATACAGTACAGG; rnp-7 sgRNA B: ACTAGTAGGTCCTGGCATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3441 |
C. elegans |
arx-6(ve941[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)] III. Sterile. Deletion of 651 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) grotty adults with vulval blip (ve941 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: GCGTCACACGCTCCAGGCAGCTCTCTGTCT; Right flanking sequence: GAATTTTTGAAGCGTTTCAATTAAttttct. arx-6 sgRNA A: TGAGCAATTCAGTTCGCAGG; arx-6 sgRNA B: TTCAGCAGAAACACGGGCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3478 |
C. elegans |
let-805(ve978[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)] III. Emb. Deletion of 22058 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), dead embryos (ve978 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: aggtagaaaaaatgtagactagccccccct; Right flanking sequence: tcgttttccaaattaatcagaaattagcat. let-805 sgRNA #1: tgagtcagcagaggccgggg; let-805 sgRNA B: attacGTTGGGTTGCAGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3493 |
C. elegans |
rars-1(ve993[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)] III. Larval arrest. Deletion of 2015 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) arrested larvae (ve993 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Note: this strain exhibits ectopic body wall GFP expression. Left flanking Sequence: aaggctcgacatgtaattacacacatacCT; Right flanking sequence: AGGGGAACATCAAGTCCAGGGAATGCATCT. rars-1 crRNA A: GTTATTGAAAATAAGGAAGG; rars-1 crRNA B: TTGGAGTTTCAGCGAGGAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|