More Fields
Strain Species Genotype
AA107 C. elegans nhr-48(ok178) X. Show Description
ZK662.3 Homozygous. No obvious phenotype. Outer left primer sequence: TCTGAAGTTTGTGAGCCGTG. Outer right primer sequence: AGCGCCTAGATGAGCAACAT. Inner left primer sequence: TCCGTTGAATGCCATCTGTA. Inner right primer sequence: GGACGATGCACATGAGTTTG. Inner primer PCR product length: 3324 bp. Deletion size: 1956 bp.
ABR212 C. elegans acd-1(sta6) delm-2(ok1822) I. Show Description
acd-1 and delm-2 are tandem paralogs. This double mutant was created by CRISPR-engineered deletion of acd-1 in a delm-2(ok1822) background (parental strain RB1523). acd-1(sta6) is predicted to be a null allele (~200bp indel causing frameshift in exon 4).
ABR225 C. elegans acd-1(sta6) delm-2(ok1822) I; delm-1(ok1266) IV. Show Description
acd-1 and delm-2 are tandem paralogs. This double mutant was created by CRISPR-engineered deletion of acd-1 in a delm-2(ok1822) background (parental strain RB1523). acd-1(sta6) is predicted to be a null allele (~200bp indel causing frameshift in exon 4). This triple mutant strain was made by crossing the acd-1(sta6) delm-2(ok1822) double mutant with delm-1(ok1226) parental strain RB1177.
AD213 C. elegans spe-19(eb52) V; asEx83. Show Description
asEx83 [spe-19(+) + myo-3p::GFP]. Pick GFP+ to maintain. asEx83 contains 7.3kb genomic fragment including spe-19 (Y113G7A.10) and 850bp of upstream sequence. Transgene rescues spe-19(eb52) sperm activation defect. GFP+ hermaphrodites are fertile. non-GFP hermaphrodites are sterile. All males are fertile.
AGD927 C. elegans uthIs270. Show Description
uthIs270 [rab-3p::xbp-1s (constitutively active) + myo-2p::tdTomato]. Pick animals with red pharynx to maintain. Reference: Taylor RC, Dillin A. Cell. 2013 Jun 20;153(7):1435-47.
AH159 C. elegans sra-13(zh13) II. Show Description
sra-13(zh13) mutants display stronger chemotaxis to limiting concentrations of isoamylalcohol and diacetyl than WT animals. Deletion allele. 396 bp of 5' promoter sequence and all but the last exon are removed; probably a null allele.
AUM1870 C. elegans ZK813.1(viz166[fln-1p::ZK813.1]) X. Show Description
The endogenous promoter of ZK813.1 (1046 bp) was replaced with the fln-1 promoter (947 bp) to limit the expression of ZK813.1 to the spermatheca and allow analysis of RNA transfer from soma to oocytes. Reference: Trimmer KA, et al. Cell Rep. 2023 May 23;42(6):112544. doi: 10.1016/j.celrep.2023.112544. PMID: 37227820. .
AV630 C. elegans meIs8 II. Show Description
meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. Transgene contains a combination of cDNA and genomic sequences of cosa-1 including 212 bp of 3'UTR. GFP is expressed in the adult germline as 6 bright foci per nucleus (one per chromosome pair) from late pachytene through diplotene stages. Reference: Yokoo R, et al. Cell. 2012 Mar 30;149(1):75-87.
AV828 C. elegans nbs-1(me102) meIs8/mIn1 [mIs14 dpy-10(e128)] II. Show Description
meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. Transgene contains a combination of cDNA and genomic sequences of cosa-1 including 212 bp of 3'UTR. GFP is expressed in the adult germline as 6 bright foci per nucleus (one per chromosome pair) from late pachytene through diplotene stages. Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP me103 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. nbs-1(me103) homozygotes have frayed and aggregated chromosomes at diakinesis of meiosis I. References: Girard C, et al. Proc Natl Acad Sci U S A. 2018 May 8;115(19):E4443-E4452. Yokoo R, et al. Cell. 2012 Mar 30;149(1):75-87.
AX7884 C. elegans pod-2(syb1772[pod-2::His10]) II; mccc-1(syb1666[mccc-1::His10]) IV; pyc-1(syb1680[pyc-1::His10]) V; pcca-1(syb1626[pcca-1::His10]) X. Show Description
Superficially wild-type. Referred to as MP3-His. Strain can be used to biotinylated carboxylases from worm extracts. AX7884 obtained by crossing parental strains PHX1772 pod-2(syb1772[pod-2::His10]) II, PHX1666 mccc-1(syb1666[mccc-1::His10]) IV, PHX1680 pyc-1(syb1680[pyc-1::His10]) V and PHX1626 pcca-1(syb1626[pcca-1::His10]) X to obtain the quadruple His10-tagged strain. The 5xGlycine(G-linker)-His10 tag is a 45 bp sequence (GGAGGAGGAGGAGGACACCATCACCATCACCACCACCACCACCAC) encoding five glycine as a linker and ten histidine residues was knocked in at the C terminus-just upstream of the termination codon-of each of the four carboxylases. Reference: Artan M, et al. J Biol Chem. 2022 Aug 3:102343. doi: 10.1016/j.jbc.2022.102343. Epub ahead of print. PMID: 35933017.
AY161 C. elegans mul-1(syb1027) IV. Show Description
F49F1.6. mul-1(syb1027) [IV:4121342..4123166] is a CRISPR/Cas9-engineered ?1,650-bp deletion mutant of isoforms A and B (565 bp and 952 bp deleted, with generated termination codon), leaving a predicted truncated protein of 46 amino acids. Derived by out-crossing parental strain PHX1027 (Suny Biotech) with N2 six times. Reference: Hoffman CL, et al. mBio. 2020 Mar 3;11(2):e00060-20. PMID: 32127446
AY162 C. elegans mul-1(syb1027) IV; acEx162. Show Description
acEx162 [mul-1p::mul-1::SL2::GFP + myo-2p::mCherry]. Pick mCherry+ to maintain. GFP expression in the intestine. acEx162 transgene rescues mul-1(lf). mul-1(syb1027) [IV:4121342..4123166] is a CRISPR/Cas9 ?1,650-bp deletion mutant of isoforms A and B (565?bp and 952?bp deleted, with generated termination codon), leaving a predicted truncated protein of 46 amino acids. Reference: Hoffman CL, et al. mBio. 2020 Mar 3;11(2):e00060-20. PMID: 32127446
BR2815 C. elegans nep-1(by159) II. Show Description
1450 bp deletion. Deletion removes 245 bp of promoter, 1st exon and 2nd exon.
BR2823 C. elegans chn-1(by155) I. Show Description
989bp deletion. Primers used: RB1537 (external left): CAAGCTTAATTTGCACACAATGCGTCAG; RB1540 (external right): AGAAGAGGCAAGAATGGAACTTGTGCG; RB1538 (internal left): AACAATTTCCGCTTATTTTCAGCGTTTG; RB1539 (internal right): CTGAACCATTGAAAGCTTTTCAGATC. Deletion breakpoints (T09B4 coordinates): 32756/33746 through 32757/33747.
BR4006 C. elegans pink-1(tm1779) II; byEx655. Show Description
byEx655 [pink-1p::pink-1::GFP + myo-2p::mCherry + herring sperm DNA]. Pick mCherry+ animals to maintain. pink-1 translational GFP (C-terminal GFP) fusion generated by cloning the complete pink-1 genomic fragment (3191 bp) with a 6-kb upstream promoter region and into pPD117.01. Reference: Sämann J, et al. J Biol Chem. 2009 Jun 12;284(24):16482-91.
BRC566 C. elegans antIs31 II; unc-119(ed9) III. Show Description
antIs31 [attP-f + Cbr-unc-119(ant40) + glh-2p::phiC31 + rol-6(partial) + myo-2p::GFP + attP-r] II. Unc. antIS31 has been found to self-excise; check for GFP expression periodically to retain the insertion. GFP expression in pharynx is very weak (as it is in single copy) and is easiest to see during the L1-L3 stages. This strain contains a phiC31 docking site and can be used for precise single-copy integration of transgenes via recombination mediated cassette exchange. The docking site contains inverted phiC31-attP sites flanking phiC31 integrase expressed from the glh-2 germline promoter. Integration constructs need to have inverted phiC31-attB sites that flank the intended sequence to be inserted. antIs31 was derived by CRISPR/Cas9 knockout of Cbr-unc-119 in antIs30 creating ant40, a 691 bp deletion in Cbr-unc-119. Because antIs31 does not rescue unc-119(ed3), BRC566 facilitates the use of Unc-119 rescue as a selection marker for transgene insertions. Reference: Yang FJ, et al. "phiC31 integrase for recombination mediated single copy insertion and genome manipulation in C. elegans." Genetics 2021.
BS3727 C. elegans lip-1(ok154) IV. Show Description
Temperature-sensitive allele. Can be grown at 20C with reduced fertility. Defects in pachytene progression, small oocyte formation and Emo are highly penetrant at 25C. ok154 is a null allele; 1504 bp deletion from -156 bp to +1348 bp, removes the start codon. Reference: Proc Natl Acad Sci USA. Das D, et al. 2022 Jan 18;119(3):e2113649119. PMID: 35022236
BXN653 C. elegans scrm-1(cjn26) zdIs5 I. Show Description
zdIs5 [mec-4p::GFP + lin-15(+)] I. mec-4::GFP is expressed in touch neurons. Null allele of scrm-1: 2501 bp deletion and 7 bp insertion (CACACAT) removes the entire scrm-1 coding sequence (position 11688933 - 11691433 of chromosome I).
BXN723 C. elegans fzo-1(cjn20) II. Show Description
Animals display reduced body bends and thrash rates, slow growth, and fragmented mitochondria. cjn20 is a 2629 bp deletion removing nucleotides 25-2654 of the fzo-1 locus. Originally published as cjn020. Reference: Byrne JJ, et al. Cell Mol Life Sci. 2019 May;76(10):1967-1985. (PMID 30840087)
CB4037 C. elegans glp-1(e2141) III. Show Description
Temperature sensitive. Sterile at 25C. Maintain at 15C. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. [2/98: Craig Mello noticed a different embryonic phenotype in this strain as compared to the e2141 stock that Jim Priess obtained from England-the ABp fate appears WT.] [NOTE (11/16/10 - J. Hubbard): This strain is NOT synonymous with glp-1(e2144) as previously reported in Kodoyianni V, Maine EM, Kimble J. (1992) [Molecular basis of loss-of-function mutations in the glp-1 gene of Caenorhabditis elegans. Mol Biol Cell. 3,1199-213. PMID: 1457827]. As reported in Worm Breeders Gazette December 2010; 18(3), e2144 carries the mutation c2785t in exon 8, leading to the amino acid change L929F, whereas e2141 carries the mutations c2920t and a3610g in exon 8, leading to the amino acid changes R974C and T1204A.]
CB5495 C. elegans bus-10 & ZK596.4 & ZK596.5(e2715) IV. Show Description
Viable, Bus, resistant to Leucobacter Verde2, hypersensitive to Leucobacter Verde1. e2715 is a small deficiency (3191 bp) which removes all of the bus-10 exons and internal ncRNA genes ZK596.4 & ZK596.5. Reference: O'Rourke et al (in preparation).
CB6931 C. elegans bus-10 & ZK596.4 & ZK596.5(e2715) IV; dhs-29(e3014) X. Show Description
Bus, bleach-sensitive, resistant to Leucobacter Verde2 and Leucobacter Verde1. e2715 is a small deficiency (3191 bp) which removes all of the bus-10 exons and internal ncRNA genes ZK596.4 & ZK596.5. Reference: O'Rourke et al (in preparation).
CE1338 C. elegans epIs14. Show Description
epIs14 [sbp-1p::GFP + rol-6(su1006)]. Rollers. sbp-1 previously known as pin-1. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CE541 C. elegans sbp-1(ep79) III. Show Description
Slow growth, low fat stores. Viable at 15C, not at 25C. Slightly Dpy, reduced brood size, low penetrance. Maintain under normal conditions. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Liang et al., (2010) PlosOne 5:3 e9869.
CE548 C. elegans sbp-1(ep79) III; epEx141. Show Description
epEx141 [sbp-1::GFP::SBP-1 + rol-6(su1006)]. ep79 is a strong allele of sbp-1 (ts lethal). sbp-1 aka pin-1. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CE833 C. elegans sbp-1(ep176) III. Show Description
Weak sbp-1 allele. sbp-1 aka pin-1. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. NOTE: This strain carries an unknown GFP marker.
CER178 C. elegans nfki-1(cer1) X. Show Description
cer1 is a CRISPR-generated 368 bp deletion removing intron 2 and part of exon 3, creating a premature stop codon. Low penetrance of developmental defects such as abnormal L1 morphology, aberrant gonad migration, and an abnormal number of distal tip cells. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153.
CER187 C. elegans nfki-1(cer2) X. Show Description
cer2 is a CRISPR-generated 438 bp deletion + 50 bp insertion removing intron 2 and part of exon 3, creating a premature stop codon. Low penetrance of developmental defects such as abnormal L1 morphology, aberrant gonad migration, and an abnormal number of distal tip cells. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153.
CER244 C. elegans ikb-1(cer9) I. Show Description
cer9 is a CRISPR-generated 462 bp deletion at the beginning of the ikb-1 coding sequence, including the start codon (no transcript should be synthesized). Low penetrance of developmental defects such as abnormal L1 morphology, aberrant gonad migration, and an abnormal number of distal tip cells. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153.
CER323 C. elegans ubh-4(cer27) II. Show Description
Reduced brood size. Genetic interaction with rpn-9. cer27 is a 1033 bp deletion removing the start codon and nearly all of the ubh-4 coding sequence. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270
CER7 C. elegans rsr-2(tm2607) II. Show Description
Superficially wild-type. tm2607 is a 196 bp deletion + 1bp insertion that removes part of an essential gene, but produces viable animals. Reference: Fontrodona L, et al. PLoS Genet. 2013 Jun;9(6):e1003543.
CGC58 C. elegans C54E10.3(umn2[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 745 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtacccccgatgggattcgaacctgtggc ; Right flanking sequence: gggtatgcaaaatgaccgcgttttctgtga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC59 C.elegans gnrr-7(umn3[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1004 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttgttctggtttaaagccgcaaagtcttgg ; Right flanking sequence: agggtaccatcaagcaatggcattctggtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC61 C. elegans F36D4.4(umn4[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATGTACTCCCCTATATCTTCCAAACATTC ; Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC72 C. elegans npr-23(umn5[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC73 C. elegans npr-28(umn6[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 842 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TATTTGGTATCATTTTTCTAGCCGACTTTC ; Right flanking sequence: TGGACTTGTTTTCACTCATCCCTGTACCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC78 C. elegans C04C3.6(umn8[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 1123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaatcaactatttttaatgaaaatttca ; Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC81 C. elegans C09F12.3(umn9[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozgous viable. Deletion of 1171 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acaatttacattaacttttcattatttcag ; Right flanking sequence: tggatgtgcattttttcgctgctcactctt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CH116 C. elegans hsb-1(cg116) IV. Show Description
Viable and fertile. Deletion of 664 bp, molecular null.
CH1179 C. elegans unc-36(e251) emb-9(g23cg46)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and 3-fold lethals. cg46 is a 497 bp deletion that removes the last 22 nucleotides of intron 9 and 475 nucleotides of exon 10;
CH1315 C. elegans zmp-1(cg115) III. Show Description
Superficially wild-type. 2366 bp deletion (965-3330 of U41266(EGAP1)) caused by imprecise excision of Tc1. Deletion can be detected by PCR with primers DSP4 (AATTAGTTGACGAGACAAGTCAGG) and B3 (AGTGAAGGCAGAATGTACTCC) --306 kb WT vs 1.2 kb mutant.
CL2179 C. elegans smg-1(cc546) I; dvIs179. Show Description
dvIs179 [myo-3p::GFP::3' UTR(long) + rol-6(su1006)]. Maintain at 16C. Superficially wild-type Roller; expression of GFP in body wall muscles increases with temperature. References: Link CD, et al. (2006) J Biol Chem. Jan 20;281(3):1808-16. Hassan WM, et al. (2014) Neurobiology of Aging. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
CL2337 C. elegans smg-1(cc546) I; dvIs38. Show Description
dvIs38 [myo-3p::GFP::degron::3' UTR(long) + rol-6(su1006)]. Maintain at 16C. Rollers. Temperature-dependent expression of aggregating GFP in body wall muscle (weak at 16C, strong at 25C). Animals become paralyzed if upshifted as larvae to 25C due to expression of aggregating GFP. References: Link CD, et al. (2006) J Biol Chem. Jan 20;281(3):1808-16. Hassan WM, et al. (2014) Neurobiology of Aging. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
CL2355 C. elegans smg-1(cc546) dvIs50 I. Show Description
dvIs50 [pCL45 (snb-1::Abeta 1-42::3' UTR(long) + mtl-2::GFP] I. Maintain at 16C. Pan-neuronal expresion of human Abeta peptide. Constitutive intestinal expression of GFP from marker transgene. Strain shows deficits in chemotaxis, associative learning, and thrashing in liquid. Strain also has incomplete sterility due to germline proliferation defects and embryonic lethality. Maintain at 16 C to reduce selection against transgene, although this does not alter the partial sterility. Reference: Wu Y., et al. J Neurosci. 2006 Dec 13;26(50):13102-13. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
CL2621 C. elegans smg-1(cc546) I; dvIs75. Show Description
dvIs75 [myo-3::Abeta 1-42 G37L::3' UTR(long) + mtl-2::GFP)]. Temperature-inducible induction of human Abeta peptide in body wall muscle; paralysis in ~32 hr if induced as L3 larvae. Maintain at 16 C to prevent strong Abeta induction and larval paralysis/arrest. Reference: Fonte V., et al. Mol Neurodegener. 2011 Aug 23;6(1):61. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
CL2659 C. elegans smg-1(cc546) I; dvIs770. Show Description
dvIs770 [myo-3::Abeta 1-42 wt::3' UTR(long) + mtl-2::GFP]. Maintain at 16 C to prevent strong Abeta induction and larval paralysis/arrest. Temperature-inducible induction of human Abeta peptide in body wall muscle; paralysis in 18-24 hr if induced as L3 larvae. NOTE: dvIs770 was originally described as dvIs70 in Fonte et al, 2011. The name of this array was changed to dvIs770 to avoid confusion with dvIs70 [hsp-16.2p::GFP + rol-6(su1006)] carried in strain CL2070. Reference: Fonte V., et al. Mol Neurodegener. 2011 Aug 23;6(1):61. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
CL4176 C. elegans smg-1(cc546) I; dvIs27 X. Show Description
dvIs27 [myo-3p::A-Beta (1-42)::let-851 3'UTR) + rol-6(su1006)] X. Rollers. Temperature sensitive: needs to be propagated at 15C. Upshift larval animals to check that the worms get paralyzed and give offspring that arrest as eggs/early larvae. This strain produces low levels of beta amyloid peptide even when grown at low temperature, and therefore there is always some selection for loss of transgene copies. It is recommended to maintain growing stock plates at 15-16 degrees C by transferring small numbers of animals each generation rather than by "chunking", which increases the effective population size and therefore the chance of a relatively rare transgene loss, and then this revertant taking over the population. The strain should also be frozen shortly after being received. This strain can only be sent to academic users and not to commercial organizations. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
CL6180 C. elegans smg-1(cc546) I; dvIs19 III; skn-1(zu67)/nT1 [unc-?(n754) let-?] (IV;V); dvIs27 X. Show Description
dvIs19 [(pAF15) gst-4p::GFP::NLS] III. dvIs27 [myo-3p::A-Beta (1-42)::let-851 3'UTR) + rol-6(su1006)] X. Roller with weak constitutive GFP expression. Balanced strain, segregates Rol Uncs [skn-1(zu67) heterozygotes], Rol nonUncs [skn-1(zu67) homozygotes] and dead eggs. Maintain by picking Rol Uncs. Paralyzed if upshifted as larvae to 25C. References: Dostal, V and Link CD (2010) J Vis Exp. Oct 9;(44). Dostal V, Roberts CM, Link CD (2010) Genetics Nov;186(3):857-66. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
CL802 C. elegans smg-1(cc546) I; rol-6(su1006) II. Show Description
Rollers. Maintain under normal conditions. Standard control for CL4176; originally used CL1175 as the control, but subsequently it was found that CL1175 can produce some A-Beta. Reference: Fonte V., et al. Mol Neurodegener. 2011 Aug 23;6(1):61. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
COP2012 C. elegans agl-1(knu867) II. Show Description
Superficially wild-type. knu867 is a 6955 bp deletion in agl-1. This strain may not be distributed to commercial or for-profit entities. Please contact ethan@perlara.com for more information.services/. For more information, please contact ethan@perlara.com