Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
CB4628 C. elegans tra-2(e1095) II; fem-1(e1927) IV; xol-1(y9) X. [XX females and tra-2; fem-1/+; xol-1 XX males] Show Description
Obligate male/female strain; maintain by crossing. Anatomically normal XX females and XX males. Male/female strain with sex determined by fem-1(+). Reference: Strain 11 in Hodgkin (2002) PMID: 12399387.
CB4706 C. elegans tra-2(e1095) II; fem-1(e1927) IV; xol-1(y9) X. [XX females and tra-2; fem-1; xol-1; eEx14[fem-1(+)] XX males] Show Description
Obligate male/female strain; maintain by crossing. Anatomically normal XX females and XX males. Male/female strain with sex determined by an extrachromosomal transgene array carrying fem-1(+). Reference: Strain 16 in Hodgkin (2002) PMID: 12399387.
CB4734 C. elegans tra-2(e1095)/+ II; fog-2(q71) V; xol-1(y9) X. [XX females and tra-2; fog-2; xol-1 XX males] Show Description
Obligate male/female strain; maintain by crossing. Anatomically normal XX females and XX males. Male/female XX strain with sex determined by tra-2(+). Reference: Strain 6 in Hodgkin (2002) PMID: 12399387.
CB5190 C. elegans tra-2(e2020) II; tra-1(e1099)/+ III; xol-1(y9) X. Show Description
Heterozygous. Maintain by picking fertile hermaphrodites. Stable XX male/female strain (fertile XX females and low fertility XX males); males sire only female progeny. Reference: Strain 3 in Hodgkin (2002) PMID: 12399387.
CB5265 C. elegans sup-1(e995e2636) III; unc-17(e245) IV; xol-1(y9) X. Show Description
Severely uncoordinated coiler, slow growing. Useful strain for selecting non-Sup-1 suppressors of unc-17(e245). Reference: Mathews et al. (2012) PMID: 23051648.
CB5300 C. elegans fem-1(hc17) IV; xol-1(y9) X. Show Description
WT hermaphrodite if grown at 15-20C. WT females if grown at 25C. When crossed, these females yield only XX viable hermaphrodite progeny, all XO progeny are dead.
CB5362 C. elegans tra-2(ar221) II; xol-1(y9) X. Show Description
ar221 is a tra-2 ts allele. Strain will grow at 15C as Egl hermaphrodites. When grown at 25C, all animals mature into X males, many of which are fertile. Good source of pure XX mating males. ar221 isolated by Jane Hubbard.
CB5590 C. elegans her-1(e1518) sdc-3(y52) V; xol-1(y9) X. [XX hermaphrodites, her-1/+ sdc-3/sdc-3; xol-1 XX males] Show Description
Maintain by crossing males and hermaphrodites; may revert to purely hermaphrodite line. Fertile hermaphrodites and fertile males. Obligate XX strain with sex determined by her-1 V. Reference: Strain 9 in Hodgkin (2002) PMID: 12399387.
CB5638 C. elegans sup-34(e2227)/+ I; tra-3(e1107) IV; xol-1(y9) X. [XX hermaphrodites and tra-3; xol-1 XX males] Show Description
Male/hermaphrodite strain, propagate by crossing. Fertile XX hermaphrodites and fertile XX males. Obligate XX strain with sex determined by amber-suppressing tRNA, sup-34. Reference: Strain 14 in Hodgkin (2002) PMID: 12399387.
CB6452 C. elegans dpy-25(e817) II; xol-1(y9) X. Show Description
Severe dumpy; dominant, hence crossing with wild-type males yields dumpy hermaphrodites and dead eggs (dpy-25/+; xol-1/0).
CX2357 C. elegans odr-5(ky9) X. Show Description
Defective chemotaxis to some volatile odorants: benzaldehyde, 2-butanone, isoamyl alcohol. Linked sterility has not been separated from Odr phenotype.
DZ683 C. elegans tra-2(ar221) II; xol-1(y9) X; rdIs4. Show Description
rdIs4 [ehn-3a::Venus(delta)]. Temperature-sensitive. Must be maintained at 15°C to produce progeny. Strain develops as hermaphrodites at 15°C (some animals are intersex with male tails), and develops as XX pseudomales at 25°C. GFP expressed in gonadal precursors. Reference: Kroetz MB & Zarkower D. G3 (Bethesda). 2015 Oct 23;5(12):2831-41.
DZ685 C. elegans xol-1(y9) X; rdIs4. Show Description
rdIs4 [ehn-3a::Venus(delta)]. Slightly Egl. Male lethal. GFP expressed in gonadal precursors. Reference: Kroetz MB & Zarkower D. G3 (Bethesda). 2015 Oct 23;5(12):2831-41.
MT5222 C. elegans sem-5(n2030)/unc-10(e102) xol-1(y9) dpy-6(e14) X. Show Description
Heterozygotes are WT and segregate WT, Vuls (bags) and DpyUncs. n2030: Vul; impenetrant Mel (rod-like larval-lethal).
MY9 C. elegans Show Description
Natural isolate; obtained in July 2002 from compost heap in Roxel, Münster, North-West Germany; frozen within 5 generations after isolation; microsatellite genotype "EU3".
NH2106 C. elegans ceh-20(ay9) III. Show Description
Egl (Vul). 90% penetrant. lesion: M78I.
OU6 C. elegans png-1(cy9) I; cyIs4. Show Description
cyIs4 [cat-1::GFP + rol-6(su1006)]. Reference: Habibi-Babadi N, et al. J Neurosci. 2010 Feb 3;30(5):1766-76.
TY1077 C. elegans C25D7.12(y128) unc-76(e911)/sdc-3(y52) unc-76(e911) V; xol-1(y9) X. Show Description
Heterozygotes are Unc and segregate Uncs, Dpy Uncs [C25D7.12(y128) unc-76(e911) homozygotes], and Tra Uncs [sdc-3(y52) unc-76(e911) homozygotes]. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
TY1807 C. elegans xol-1(y9) X. Show Description
Fully penetrant XO lethal. XX is WT. Enhancer of her-1(sd), tra-2(lf), tra-3(lf) XX masculinization phenotypes. Does not enhance tra-1(lf).
TY418 C. elegans dpy-21(y47) V. Show Description
Isolated as a suppressor of xol-1(y9). Dpy. Throws males. Pick L4 hermaphrodites to maintain. dpy- 21(y47) is a nonsense mutation predicted to terminate translation at codon 1396, and can be suppressed by the amber suppressor sup-7. Reference: Yonker SA & Meyer BJ. Development. 2003 Dec;130(26):6519-32.
TY525 C. elegans him-8(e1489) IV; xol-1(y9) X. Show Description
Fully penetrant XO lethal. XX is WT. Enhancer of her-1(sd), tra-2(lf), tra-3(lf) XX masculinization phenotypes. Does not enhance tra-1(lf).
TY574 C. elegans dpy-21(y59) V. Show Description
Isolated as a suppressor of xol-1(y9). Dpy. Throws males. Pick L4 hermaphrodites to maintain. dpy- 21(y59) is a nonsense mutation predicted to terminate translation at codon 417, and can be suppressed by the amber suppressor sup-7. Reference: Yonker SA & Meyer BJ. Development. 2003 Dec;130(26):6519-32.
BC10180 C. elegans dpy-5(e907) I; sEx10180. Show Description
sEx10180 [rCes Y94H6A.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC13032 C. elegans dpy-5(e907) I; sEx13032. Show Description
sEx13032 [rCes Y97E10AR.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC13565 C. elegans dpy-5(e907) I; sEx13565. Show Description
sEx13565 [rCes Y95B8A.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC14767 C. elegans dpy-5(e907) I; sEx14767. Show Description
sEx14767 [rCes Y9C9A.14::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC14768 C. elegans dpy-5(e907) I; sEx14768. Show Description
sEx14768 [rCes Y9C9A.15::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC16028 C. elegans dpy-5(e907) I; sEx16028. Show Description
sEx16028 [rCes Y9C9A.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC16030 C. elegans dpy-5(e907) I; sEx16030. Show Description
sEx16030 [rCesY9C9A.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC16205 C. elegans dpy-5(e907) I; sEx16205. Show Description
sEx16205 [rCes Y9C9A.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
CHS1176 C. elegans str-170(yum2047) str-171(yum2048) str-172(yum2049) str-173(yum2050) str-174(yum2051) str-175(yum2052) str-166(yum2053) y9c9a.5(yum2054) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
DM7388 C. elegans pha-1(e2123) III; raEx388. Show Description
raEx388 [T05G5.1p::Y9C2UA.1(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
EG8952 C. elegans oxTi1016 I. Show Description
oxTi1016 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:-18.09). Insertion into Y95B8A.8. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.
IG125 C. elegans frP15 IV. Show Description
Mos1 transposon insertion: Y97E10B (at position 1022) acacctggtaAAACATGCTGAAAGTTTACTAAAATTGAAT. Mos1 sequence is in lowercase.
JJ1550 C. elegans dpl-1(zu355) unc-4(e120)/rol-6(e187) let-23(sy97) II. Show Description
Heterozygotes are WT and segregate WT, Uncs which give only deads egss with a Mex phenotype, and Vulvaless Rollers. sy97 is only 15% viable.
MT7052 C. elegans lin-45(sy96) unc-24(e138) IV. Show Description
NK2621 C. elegans eif-1.A(qy90[eif-1.A::mNG]) IV. Show Description
mNG tag inserted into the C-terminus of the endogenous eif-1.A locus.
NK2623 C. elegans ucr-2.1(qy92[ucr-2.1::mNG]) X. Show Description
mNeonGreen tag inserted into the endogenous ucr-2.1 locus (C-terminus tag). Insertion verified by PCR. Left flanking sequence: 5' TCAGAAGGAACGACTCGTTG 3' ; Right flanking sequence: 5' CGAAAGTAGAATGCTAGTCAAG 3'. sgRNA: 5' TTTATAGCTCGTCGAGATAT 3'. Superficially wild-type.
NK2633 C. elegans elo-1(qy97[elo-1::mNG]) IV. Show Description
mNG tag inserted into the C-terminus of the endogenous elo-1 locus.
NK2636 C. elegans fasn-1(qy98[fasn-1::mNG]) I. Show Description
fasn-1 locus endogenously tagged with mNG at the C-terminus. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
NK3080 C. elegans cpIs91 II; sbp-1(qy94[mNG::sbp-1]) III. Show Description
cpIs91 [lag-2p::2x mKate2::PLC(delta)PH::3xHA::tbb-2 3'UTR LoxN] II. sbp-1 locus endogenously tagged with mNG at the N-terminus. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
NK3086 C. elegans cpIs91 II; ucr-2.1(qy92[ucr-2.1::mNG]) X. Show Description
cpIs91 [lag-2p::2xmKate2::PLCdeltaPH::3xHA::tbb-2 3'UTR LoxN] II.  mNeonGreen tag inserted into C-terminus of endogenous ucr-2.1 locus. lag-2 driven red plasma membrane marker.
PD3165 C. elegans unc-39(ct73) V; ccEx3163. Show Description
ccEx3163 [unc-39p::unc-39 gene (genomic fragment)::GFP::unc-39 3'UTR + rol-6(su1006)]. Maintain by picking Rollers. ccEx3163 carries unc-39 construct pJLY99.1.
PJ1069 C. elegans let-60(sy93) IV; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Dominant Vul allele, however, worms appear to be Egl and have multiple pseudovulvae (due to sup-7??).
PJ1092 C. elegans lin-45(sy96) IV; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V.
PJ1099 C. elegans lin-45(sy96) let-60(ga89) IV; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Vul. Non-Clr at 25C. Poor growers (sub-viable?) at 25C.
PJ1110 C. elegans clr-1(e1745) II; lin-45(sy96) IV; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. sy96 appears to suppress the Clr phenotype of e1745. Lots of Bags and larval lethals.
PS295 C. elegans let-23(sy97) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozgyotes are WT and segregate WT, DpyUncs and Vulvaless Unc-4s. sy97 is only 15% viable. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC.
PS427 C. elegans lin-45(sy96) IV. Show Description
Vulvaless. 90% of the progeny are larval lethal-most die as L1s. Males are mating defective. Do not distribute this strain; other labs should request it from the CGC.
PS436 C. elegans let-60(sy93) IV. Show Description
Dominant Vul (>99% Egl). Do not distribute this strain; other labs should request it from the CGC.