Search Strains

luc30 removes mir-791/mir-790 binding sites in the unc-9 3'UTR. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047.

Unc.

Unc. Males are fertile.

Cold sensitive Unc.

Cold sensitive Unc.

Cold sensitive Unc.

Break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Unc Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

DpyUnc.

Kinkers. References: Yeh E, et al. J Neurosci. 2009 Apr 22;29(16):5207-17. Kawano T, et al. Neuron. 2011 Nov 17;72(4):572-86.

Break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Balancer marked with myo-2p::mCherry. Unc Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Balancer marked with myo-2p::Venus. Unc Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

tmIs1240 [myo-2p::Venus, X: F23D12.4] X. tmEx4950 [unc-9(+) + vha-6p::GFP]. Pick non-Unc with bright GFP+ in gut to maintain array. Balancer marked with myo-2p::Venus. Mec (Unc). Balancer break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Males carrying the array (intestinal GFP) can mate. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

tmIs1233 [myo-2p::mCherry, X: F23D12.4] X. tmEx4950 [unc-9(+) + vha-6p::GFP]. Pick non-Unc with bright GFP+ in gut to maintain array. Balancer marked with myo-2p::mCherry. Mec (Unc). Balancer break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Males carrying the array (intestinal GFP) can mate. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Temperature-sensitive Lin.

Animals heterozygous for yDp4 are Dpy non-Flu non-Unc. Animals which have lost yDp4 are FluUnc. Animals homozygous for yDp4 are dead (embryonic lethal). Low percentage of non-Dpy non-Unc progeny. These give a high percentage of Unc male self-progeny and are inferred to be yDp4 XO hermaphrodites.

Lon non-Unc hermaphrodite strain. yDp5 is homozygous viable. yDp5/+ XO animals are fertile males.

Lon non-Unc hermaphrodites. yDp6 is homozygous viable. yDp6/+ XO animals are fertile males.

Animals heterozygous for yDp7 are Lon non-Unc. Animals which have lost yDp7 are LonUnc. Animals homozygous for yDp7 are Dpy and sick hermaphrodites. yDp7/+ XO males are Dpy and infertile. yDp7 attached to an autosome.

Animals heterozygous for yDp8 are Lon non-Unc hermaphrodites. Animals which have lost yDp8 are LonUnc. Animals homozygous for yDp8 are Dpy and sick hermaphrodites. yDp8/+ XO males are Dpy and infertile.

Lon non-Unc hermaphrodite strain. yDp9 is homozygous viable. yDp9/+ XO animals are fertile males.

Animals heterozygous for yDp10 are Lon non-Unc hermaphrodites. Animals which have lost yDp10 are LonUnc. Animals homozygous for yDp10 are Dpy and sick hermaphrodites. yDp10/+ XO animals are Dpy and infertile males.

Lon non-Unc hermaphrodite strain. yDp11 is homozygous viable. yDp11/+ XO animals are fertile males.

Free duplication. Animals with yDp12 are Lon non-Unc hermaphrodites. Animals which have lost yDp12 are LonUnc. yDp12/+ XO animals are fertile males.

Temperature sensitive Muv. Semi-dominant Dpy. Unc-moves backward better than forward; slight kinker in forward movement; larvae more severly Unc.

maIs103[rnr::GFP unc-36(+)] X. The heDf1 deletion includes cdk-4. Heterozygotes produce 1/4 thin, sterile, uncoordinated animals that fail to undergo postembryonic somatic cell divisions. heDf1 mutants are of L1 size, smaller than cdk-4 mutants. lon-2 and unc-9 do not exactly balance heDf1, but unc-9 is pretty close. It should also be possible to follow the heterozygotes by looking at the GFP. Despite trying, unable to separate the maIs integration from heDf1 or the other cdk-4 alleles. By maintaining animals with GFP (visible especially in early animals and in eggs) you should be able to maintain heDf1. rnr::GFP is expressed during S-phase in heterozygous animals. rnr::GFP expression is not detected in heDf1 animals. maIs103 is tightly linked to heDf1. Maintain by picking several single animals and scoring for 1/4 mutant progeny.

Larval lethal mutation balanced by tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)]. Balancer marked with myo-2p::Venus. Maintain by picking non-Unc GFP+ animals. Heterozygotes are wild-type GFP+ and segregate wild-type GFP+ heterozygotes, non-GFP mg663 homozygotes (lethal), and Unc GFP+ (homozygous tmC24). Reference: Warnhoff K & Ruvkun G. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0249-y.

tmIs1240 [myo-2p::venus, X: F23D12.4] X. Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous let-7 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type GFP+ mScarlet+ and segregate wild-type GFP+ mScarlet+ heterozygotes, mScarlet+ non-GFP dead larvae (umn45 homozygotes) and Mec(Unc) non-mScarlet GFP+ (tmC24 homozygotes). Maintain by picking wild-type GFP+ mScarlet+. Left Flanking: GCAAGCAGGCGATTGGTGGACGGTC, Right Flanking: AGCTGCGTCGTCTTGCTCTCACAAc. sgRNA: AAAATTGCATAGTTCACCGG.

otEx7109 [unc-9(fosmid WRM0611aH10)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.

juIs463 [flp-13p::GFP1-10 + ttx-3p::RFP]. 7xGFP11 tag inserted into endogenous unc-9 locus. unc-9(miz81) is Unc, possibly due to increased channel activity. Reference: Hendi A, et al. Elife. 2022 Nov 15;11:e80555. doi: 10.7554/eLife.80555. PMID: 36378164.

Recessive Suppressor. XO Fertile hermaphrodite. WT phenotype.

Made by outcrossing HE110 four times. su110 is moderately Smg suppressible: HE110 animals are significantly less Unc than DV2208, and HE110 animal are also pVul, which is characteristic of Smg mutations.

Adults are Unc - reduced motility; characteristic birefrigent "needles" in body wall muscle cells by polarized light microscopy; contain accumulations of paramyosin and UNC-98. Phenotype (needles and accumulations of paramyosin) is suppressed by growth at 15C or by starvation.

Adults are Unc - reduced motility; characteristic birefrigent "needles" in body wall muscle cells by polarized light microscopy; contain accumulations of paramyosin and UNC-96.

Adults are Unc - reduced motility; disorganization of myofilament lattice in body wall muscle cells by polarized light microscopy; abnormal accululations of F-actin near muscle cell-cell boundaries.

Heterozygotes are WT and segregate WT, DpyUncs and Sterile Unc-36 which have an everted vulva. Do not distribute this strain; other labs should request it from the CGC.

Variable phenotype-WT when relaxed. Paralyzed. Dave Reiner identified smg-1(re1) in this strain.

Movement WT. Body muscle abnormal.

Movement WT. Body muscle abnormal.

Slow moving Unc. Body muscle abnormal. Slightly small.

Unc-very slow or paralysed. Egl. Semi-dominant.

Heterozygotes are wild-type and segregate wild-type heterozygotes, sterile Mog, and Unc Dpy. Pick wild-type and check for proper segregation of progeny. Do not distribute this strain; other labs should request it from the CGC.

mNG reporter inserted into endogenous unc-94 locus, specifically tagging the UNC-94A isoform. Reference: Zhang P, et al. 2023 Sep 4;222(9):e202302102. doi: 10.1083/jcb.202302102.

mNG reporter inserted into endogenous unc-94b locus, specifically tagging the UNC-94B isoform. Reference: Zhang P, et al. 2023 Sep 4;222(9):e202302102. doi: 10.1083/jcb.202302102. PMID: 37351566.

mNG reporter inserted into endogenous unc-94b locus. m-Scarlet-I reporter inserted into endogenous cap-1 locus. Reference: Zhang P, et al. 2023 Sep 4;222(9):e202302102. doi: 10.1083/jcb.202302102. PMID: 37351566.

Phenotype: small, scrawny, thin, lays few eggs. unc-93(e1500) rubberband phenotype is completely suppressed by sup-11(n403) so only sup-11 phenotype is visible. n403 is semidominant.

Suppressor of unc-93(e1500). Weak maternal effect sterile and dumpy. Reference: Ma L, Horvitz HR. PLoS Genet. 2009 Nov;5(11):e1000708.

Suppresses unc-93(e1500).