More Fields
Strain Species Genotype
HE110 C. elegans smg-1(re1) I; unc-97(su110) X. Show Description
Variable phenotype-WT when relaxed. Paralyzed. Dave Reiner identified smg-1(re1) in this strain.
DV3208 C. elegans daf-15(re147[daf-15::mNG::2xHA]) IV. Show Description
mNeonGreen tag inserted at 3' end of endogenous daf-15 locus. Ubiquitous expression.
DV3285 C. elegans his-72(cp76[mNeonGreen::3xFlag::his-72]) mpk-1(re172[mpk-1::mKate2::3xFlag]) III. Show Description
Green nuclei and ubiquitous cytosolic red expression, typically excluded from nuclei but with activity-dependent translocation into nuclei. Derived in an N2 background. C-terminally tagged mpk-1 is detectable by triplex PCR: mpk-1 genotyping FW: ACCAAAACAACCATGGGCTCG mpk-1 genotyping RV-1: GCTCCAAGTATGGGTGAGCC mpk-1 genotyping RV-2: GGTTCCCTCGTATGGCTTTCC Reference: Neal R, et al. (2021). Nuclear translocation of tagged endogenous ERK/MPK-1 MAP Kinase denotes a subset of activation events in C. elegans development.
DV3312 C. elegans rgl-1(re179[mNeonGreen::3xFlag::rgl-1]) X. Show Description
Ubiquitous expression with cytosolic localization. Derived in an N2 background. Detection with triplex primers: HS125 5’-CTTGTCACTGTAAGGGAAGATTTCC-3’ HS126 5’-TTGTCCTCCTCTCCCTTGG-3’ HS127 5’ ACGTAGAATGTTCCAGAGTTCCAG-3' Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501
DV3313 C. elegans rap-1(re180) IV. Show Description
Gain-of-function allele (G12V). Low penetrance of 3? to 1? fate transformations (Muv) and duplication of the excretory duct cell. Genotyping primers (Tm=50C, followed by BamHI digestion): oNR122: TGTGTCATCTGGTCTGTACTTGG; oNR123: TCCCCTGCACGAATTGTACC. Reference: Rasmussen NR, Dickinson DJ, and Reiner DJ. Genetics Dec;210(4):1339-1354. doi: 10.1534/genetics.118.301601. PMID: 30257933.
DV3327 C. elegans pmk-1(re170[pmk-1::mNG::3xFlag]) IV. Show Description
mNeonGreen and 3xFlag tag inserted at 3' end of endogenous pmk-1 locus. Fluorescent green signal detected in both cytosol and nuclei of all somatic cells; might be silenced in the germ line. Generated in an N2 background. Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501
MQD753 C. elegans hqIs180. Show Description
hqIs180 [sdhb-1p::mtLS::cpYFP + rol-6(su1006)]. Rollers. About four mitoflash events per anterior pharynx per 200 seconds on adult days 2-3 when cultured on standard NGM plates at 20C. In hqIs180 mtLS is a mitochondrial localization sequence from SDHB-1 and cpYFP is circularly permuted yellow fluorescent protein, a superoxide sensor (Wang W. et al., Cell, 2008). The cpYFP signal is detected in most or all tissues, but most strongly in the pharyngeal muscles. Reference: Shen E-Z, et al. Nature. 2014 Feb 12. doi: 10.1038/nature13012.
MQD774 C. elegans daf-2(e1370) III; hqIs180. Show Description
hqIs180 [sdhb-1p::mtLS::cpYFP + rol-6(su1006)]. Rollers. About two mitoflash events per anterior pharynx per 200 seconds on adult day 3 when cultured on standard NGM plates at 20 ºC. In hqIs180, mtLS is a mitochondrial localization sequence from SDHB-1 and cpYFP is circularly permuted yellow fluorescent protein, a superoxide sensor (Wang W. et al., Cell, 2008). The cpYFP signal is detected in most or all tissues, but most strongly in the pharyngeal muscles. Reference: Shen E-Z, et al. Nature. 2014 Feb 12. doi: 10.1038/nature13012.
MQD812 C. elegans daf-16(mu86) I; daf-2(e1370) III; hqIs180. Show Description
hqIs180 [sdhb-1p::mtLS::cpYFP + rol-6(su1006)]. Rollers. About three mitoflash events per anterior pharynx per 200 seconds on adult day 3 when cultured on standard NGM plates at 20 ºC. In hqIs180, mtLS is a mitochondrial localization sequence from SDHB-1 and cpYFP is circularly permuted yellow fluorescent protein, a superoxide sensor (Wang W. et al., Cell, 2008). The cpYFP signal is detected in most or all tissues, but most strongly in the pharyngeal muscles. Reference: Shen E-Z, et al. Nature. 2014 Feb 12. doi: 10.1038/nature13012.
MQD911 C. elegans hsf-1(sy441) I; hqIs180. Show Description
hqIs180 [sdhb-1p::mtLS::cpYFP + rol-6(su1006)]. Rollers. About six mitoflash events per anterior pharynx per 200 seconds on adult day 3 when cultured on standard NGM plates at 20 ºC. In hqIs180, mtLS is a mitochondrial localization sequence from SDHB-1 and cpYFP is circularly permuted yellow fluorescent protein, a superoxide sensor (Wang W. et al., Cell, 2008). The cpYFP signal is detected in most or all tissues, but most strongly in the pharyngeal muscles. Reference: Shen E-Z, et al. Nature. 2014 Feb 12. doi: 10.1038/nature13012.
SRS230 C. elegans pha-1(e2123) III; lite-1(ce314) X; sraEx230. Show Description
sraEx230 [str-2p::Arch::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AWC(on) and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is decreased upon symmetrical stimulation, and asymmetrical stimulation causes the worm to turn in the same direction the head was bent when AWC(on) was inhibited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.
SRS278 C. elegans pha-1(e2123) III; lite-1(ce314) X; sraEx278. Show Description
sraEx278 [npr-9p::Arch::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AIB and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is decreased upon symmetrical stimulation. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.
SRS279 C. elegans pha-1(e2123) III; lite-1(ce314) X; sraEx279. Show Description
sraEx279 [ttx-3p::Arch::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AIY and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is increased upon symmetrical stimulation, and asymmetrical stimulation causes the worm to turn in the opposite direction to which the head was bent when AIY was excited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.
SRS281 C. elegans pha-1(e2123) III; lite-1(ce314) X; sraEx281. Show Description
sraEx281 [ttx-3p::chop-2(H134R)::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AIY and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is decreased upon symmetrical stimulation, and asymmetrical stimulation causes the worm to turn in the same direction the head was bent when AIY was excited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.
SRS291 C. elegans pha-1(e2123) III; lite-1(ce314) X; sraEx291. Show Description
sraEx291 [npr-9p::chop-2(H134R)::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AIB and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is increased upon symmetrical stimulation. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.
SRS301 C. elegans pha-1(e2123) III; lite-1(ce314) X; sraEx301. Show Description
sraEx301 [str-2p::chop-2(H134R)::TagRFP + str-2p::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AWC(on) and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is increased upon symmetrical stimulation, and asymmetrical stimulation causes the worm to turn in the opposite direction to which the head was bent when AWC(on) was excited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.
SRS306 C. elegans pha-1(e2123) III; lite-1(ce314) X; sraEx306. Show Description
sraEx306 [ser-2(prom2)::chop-2(H134R)::TagRFP + ser-2(prom2)::mKO + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses mKO and TagRFP in AIY, AIZ and RME in the head, and has little response to blue light in the absence of ATR. In the presence of ATR asymmetrical stimulation of AIY causes the worm to turn in the same direction the head was bent when AIY was excited, whereas asymmetrical stimulation of AIZ or RME causes the worm to turn in the opposite direction to which the head was bent when AIZ or RME was excited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.
SRS329 C. elegans pha-1(e2123) III; lite-1(ce314) X; sraEx329. Show Description
sraEx329 [odr-2(18)p::chop-2(H134R)::TagRFP + odr-2(18)p::mKO + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses mKO and TagRFP in SMB in the head, and has little response to blue light in the absence of ATR. In the presence of ATR asymmetrical stimulation of SMB causes the worm to turn in the same direction the head was bent when SMB was excited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.