| GR1366 |
C. elegans |
mgIs42. Show Description
mgIs42 [tph-1::GFP + rol-6(su1006)]. Rollers.
|
|
| MT14984 |
C. elegans |
tph-1(n4622) II. Show Description
Egl. Reduced pharyngeal pumping.
|
|
| MT15434 |
C. elegans |
tph-1(mg280) II. Show Description
Backcrossed tph-1(mg280) allele. cam-1 mutation was removed by crossing left and right of tph-1(mg280) using bli-2 and unc-4. Strain does not have withered tail defect and moves well.
|
|
| EEG107 |
C.elegans |
tph-1(mg280) II; mudIs1. Show Description
mudIs1 [tph-1p::ChR2::GFP + myo-3p::mCherry]. When tph-1 mutants carrying mudIs1 are exposed to blue light, the worms continue to move rather than stopping like wild-type animals. Reference: Pokala N & Glater EE. 2018. Journal of Undergraduate Neuroscience Education. 162(2): A152-A158.
|
|
| GR1333 |
C. elegans |
yzIs71 V. Show Description
yzIs71 [tph-1p::GFP + rol-6(su1006)] V. Rollers. tph-1 transcriptional reporter containing 3.1kb of tph-1 5 regulatory sequence through the beginning of exon 4. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785. Sze JY, et al. Nature. 2000 Feb 3;403(6769):560-4.
|
|
| GR1321 |
C. elegans |
tph-1(mg280) cam-1(vs166) II. Show Description
Slow pumping. Egg laying defective. Low frequency of dauer formation. Residual serotonin immunoreactivity, rare and very faint (<1% of NSMs) in most stages, but nearly 100% of CP neurons in adult males show faint to moderate serotonin immunoreactivity. Males mate quite well (E. Hare and C. Loer). Some phenotypic defects originally attributed to mg280 in this strain are likely due to vs166. vs166 is a large deletion (approx. 9.8kb) in the cam-1 gene; flanking sequences are: 5'-gctactggtaaataaggtaa-3' and 5'-atgcttttaaagtttatatt-3' (Edith Myers, personal commnication). See MT15434 for a strain carrying mg280 without the cam-1 mutation.
|
|
| OH4134 |
C. elegans |
otIs173 III; zdIs13 IV. Show Description
otIs173[F25B3.3::DsRed2 + ttx-3promB::GFP] III. zdIs13 [tph-1p::GFP] IV.
|
|
| OH4138 |
C. elegans |
zdIs13 IV; wrk-1(tm1099) X. Show Description
zdIs13 [tph-1p::GFP] IV.
|
|
| OH4143 |
C. elegans |
vab-1(dx31) II; zdIs13 IV. Show Description
zdIs13 [tph-1p::GFP] IV.
|
|
| OH4147 |
C. elegans |
zdIs13 IV; wrk-1(ok695) X. Show Description
zdIs13 [tph-1p::GFP] IV.
|
|
| OH4127 |
C. elegans |
zdIs13 IV; oyIs14 V; wrk-1(ok695) X. Show Description
zdIs13 [tph-1p::GFP] IV. oyIs14 [sra-6::GFP + lin-15(+)] V.
|
|
| OH4135 |
C. elegans |
otIs173 III; zdIs13 IV; wrk-1(ok695) X. Show Description
otIs173[F25B3.3::DsRed2 + ttx-3promB::GFP]. zdIs13 [tph-1p::GFP] IV.
|
|
| OH4144 |
C. elegans |
vab-1(dx31) II; zdIs13 IV; wrk-1(ok695) X. Show Description
zdIs13 [tph-1p::GFP] IV.
|
|
| HZ66 |
C. elegans |
sop-2(bp186) II; him-5(e1490) bxIs16 V. Show Description
bxIs16 [cat-2::YFP + tph-1::CFP]. Temperature sensitive: lethal at 25C. Maintain at 20C.
|
|
| HZ67 |
C. elegans |
him-5(e1490) bxIs16 V; sor-3(bp185) X. Show Description
bxIs16 [cat-2::YFP + tph-1::CFP]. Temperature sensitive: lethal at 25C. Maintain at 20C.
|
|
| JY190 |
C. elegans |
osm-9(yz6) IV. Show Description
Downregulation of tph-1::GFP expression in the ADF neurons. CORRECTION: The yz6 allele had been erroneously listed as y26 in our database.
|
|
| JY243 |
C. elegans |
ocr-2(yz5) IV. Show Description
Downregulation of tph-1::GFP expression in the ADF neurons.
|
|
| JY359 |
C. elegans |
lim-4(yz12) X. Show Description
Down regulation of tph-1::GFP expression in the ADF neurons.
|
|
| LX837 |
C. elegans |
vsIs45. Show Description
vsIs45 [tph-1::GFP]. tph-1::GFP in vsIs45 is expressed exclusively in the NSM neurons in larvae and NSM + HSN in adults, whereas other tph-1::GFP reporters are also expressed in other serotonergic neurons; can be used to image NSM development and for FACS isolation of NSM from L1s. Reference: Nelson JC, Colon-Ramos DA. J Neurosci. 2013 Jan 23;33(4):1366-76.
|
|
| NFB1720 |
C. elegans |
tph-1(vlc46[tph-1::T2A::mNeonGreen]) II. Show Description
mNeonGreen tag inserted into endogenous tph-1 locus. Upstream flanking sequence: CTCTCCGCTCAGACATCAACCTGCTCGCCGGAGCTCTCCACTACATCCTG. Downstream flanking sequence: TAGTTTGAGTTTCCGTGTTTTTTATTTTTTTTATTTGGTTTCTGCTTTCT. Guide sequence: GTAGTTTGAGTTTCCGTGTT. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
| NFB509 |
C. elegans |
zdIs13 IV; vlcEx284. Show Description
zdIs13 [tph-1p::GFP] IV. vlcEx284 [hsp-16.2p::hlh-3 + ttx-3::mCherry + rol-6(su1006)]. Rollers. Extrachromosomal array containing the heat shock responsive hsp-16.2 promoter for time controlled expression of hlh-3 transcription factor cDNA. Transcriptional tph-1 GFP reporter labels the serotonergic system. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
|
|
| OH12495 |
C. elegans |
otIs517. Show Description
otIs517 [tph-1(fosmid)::SL2::YFP::H2B + ttx-3::mCherry]. Fosmid-based tph-1 reporter expresses YFP in NSM, ADF, and HSN neurons, as well as in R1B, R3B, and R9B (in males). Adult animals roll, though for reasons unknown.
|
|
| OH19337 |
C. elegans |
tph-1(ot1545) II. Show Description
ot1545 is CRISPR-engineered 2,838 bp deletion removing the entire tph-1 coding region. Sequence after edit: tgtatattacgtgccgaattccagaagcaccacgcccaacacaaagacacgttttcctgcagaagaggaa. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19767 |
C. elegans |
otIs942 V. Show Description
otIs942 [tph-1(prom5)::daf-2(DN)::eBFP2::SL2::tagRFP-T::tbb-2 3' UTR + unc-122p::GFP::unc-54 3' UTR] V. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. tph-1(prom5) drives expression of daf-2(DN) specifically in the NSM neurons. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH8014 |
C. elegans |
zdIs13 IV; otEx3567. Show Description
zdIs13 [tph-1p::GFP] IV. otEx3567 [ptph-1::hif-1(p621A) + ttx-3::RFP]. Line 1.
|
|
| OH8015 |
C. elegans |
zdIs13 IV; otEx3568. Show Description
zdIs13 [tph-1p::GFP] IV. otEx3568 [ptph-1::hif-1(p621A) + ttx-3::RFP]. Line 2.
|
|
| OH8016 |
C. elegans |
zdIs13 IV; otEx3569. Show Description
zdIs13 [tph-1p::GFP] IV. otEx3569 [ptph-1::hif-1(p621A) + ttx-3::RFP]. Line 3.
|
|
| PHX3596 |
C. elegans |
tph-1(mg280) pah-1(syb3596) II. Show Description
Significant depletion of serotonin and serotonin-derived metabolites; increase in exploration. Double mutant created by CRISPR-mediated deletion of 1450 bp spans Exon 1 to Exon 6 (the same deletion as syb3601 in PHX3601) in tph-1 background. Upstream flanking sequence: cctctgaaaaccaaatcttgttctctgaaa; Downstream flanking sequence: TCGCTGGTCTTCTTTCTTCTCGTGATTTCT.
|
|
| PHX3678 |
C elegans |
tph-1(mg280) pah-1(syb3678[GFP::H2B::T2A::pah-1]) II. Show Description
GFP tag inserted into endogenous pah-1 locus by CRISPR/Cas9.
|
|
| PHX6451 |
C. elegans |
tph-1(syb6451[tph-1::SL2::GFP::H2B]) II. Show Description
Endogenous tph-1 locus tagged by CRISPR/Cas9-engineering. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452.
|
|
| SK4013 |
C. elegans |
zdIs13 IV. Show Description
zdIs13 [tph-1p::GFP] IV. Transcriptional tph-1 reporter. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785. Clark SG & Chiu C. Development. 2003 Aug;130(16):3781-94.
|
|
| SWF415 |
C elegans |
lite-1(ce314) gur-3(ok2245) X; flvIs17; flvIs18. Show Description
flvIs17 [tag-168::NLS::GCaMP7F + gcy-28.d::NLS::tagRFPt + ceh-36::NLS::tagRFPt + inx-1::tagRFPt + mod-1::tagRFPt + tph-1(short)::NLS::tagRFPt + gcy-5::NLS-;:tagRFPt + gcy-7::NLS::tagRFPt]. flvIs18 [tag-168::NLS::mNeptune2.5]. This strain can be used for calcium imaging at whole-brain level. Back-crossed 5x to MT21793 after transgene integration. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
|
|
| SWF702 |
C elegans |
otIs670 V; lite-1(ce314) gur-3(ok2245) X; flvIs17. Show Description
flvIs17 [tag-168::NLS::GCaMP7F + gcy-28.d::NLS::tagRFPt + ceh-36::NLS::tagRFPt + inx-1::tagRFPt + mod-1::tagRFPt + tph-1(short)::NLS::tagRFPt + gcy-5::NLS-;:tagRFPt + gcy-7::NLS::tagRFPt]. See description of strain OH15263 for full description of otIs670 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). This strain can be used for pan-neuronal calcium imaging. Back-crossed 5x to MT21793 after transgene integration. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
|
|
| AGK192 |
C. elegans |
unc-119(ed3) III; zdIs13 IV; armIs5. Show Description
zdIs13 [tph-1p::GFP] IV. armIs5 [zfp-1(fosmid)::FLAG + unc-119(+)]. Integrated zfp-1 transgene expressed in the germline. Fosmid-based zfp-1::FLAG transgene fully rescues stress-sensitivity and reduced lifespan in zfp-1(ok554) homozygotes. ChIP with anti-FLAG antibody detects ZFP-1::FLAG localization to promoters of highly expressed genes. References: Mansisidor AR, et al. PLoS Genet. 2011 Sep;7(9):e1002299. Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015. Cecere G, et al. Mol Cell. 2013 Jun 27;50(6):894-907.
|
|
| AGK640 |
C. elegans |
zdIs13 IV; pak-1(ok448) X; armEx252. Show Description
zdIs13 [tph-1p::GFP] IV. armEx252 [dpy-7p::pak-1::tagRFP + myo-2::GFP]. Pick animals with GFP+ pharynx to maintain. armEx252 rescues the pak-1(ok448) HSN under-migration phenotype. pak-1::tagRFP is expressed in the hypodermal tissue throughout development and adulthood. Reference: Kennedy LM, et al. Cell Rep. 2013 Sep 12;4(5):996-1009.
|
|
| AGK650 |
C. elegans |
daf-16(mu86) I; zdIs13 IV; armEx257. Show Description
zdIs13 [tph-1p::GFP] IV. armEx257 [dpy-7p::daf-16b::tagRFP + myo-2::GFP]. Pick animals with GFP+ pharynx to maintain. armEx257 rescues the daf-16(mu86) HSN undermigration phenotype. dpy-7p::daf-16b::tagRFP expression is localized to nuclei in hypodermal tissue during the comma, 1.5 and 2-fold stages, becoming cytoplasmic or perinuclear by the 3-fold stage and persisting into adulthood. Reference: Kennedy LM, et al. Cell Rep. 2013 Sep 12;4(5):996-1009.
|
|
| BN499 |
C. elegans |
bqSi294 II; bqSi488 IV. Show Description
bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi488 [tph-1p::FLP D5 + unc-119(+)] IV. Heat shock produces green nuclei in serotonin-producing neurons and red nuclei elsewhere.
|
|
| CF3166 |
C. elegans |
muEx473. Show Description
muEx473 [kin-19p::kin-19::tagRFP + tph-1p::GFP]. Pick RFP+ GFP+ animals to maintain. Low transmission rate. Translational fusion of KIN-19 displaying age-dependent aggregation. Reference: David DC, et al. PLoS Biol. 2010 Aug 10;8(8):e1000450.
|
|
| CF3649 |
C. elegans |
muIs209. Show Description
muIs209 [myo-3p::kin-19::tagRFP + tph-1p::GFP]. KIN-19::tagRFP aggregates with age in body-wall muscles. Animals have reduced thrashing compared to controls. Generated in N2 background. References: Huang YC, et al. Elife. 2019 May 3;8. pii: e43059. doi: 10.7554/eLife.43059. David DC, et al. PLoS Biol. 2010 Aug 10;8(8):e1000450.
|
|
| DCD13 |
C. elegans |
uqIs9. Show Description
uqIs9 [myo-2p::rho1::tagRFP + tph-1p::GFP]. RHO-1::tagRFP aggregates in pharyngeal muscles. Animals have impaired pharyngeal pumping. Generated in N2 background. References: Huang YC, et al. Elife. 2019 May 3;8. pii: e43059. doi: 10.7554/eLife.43059.
|
|
| EEG108 |
C. elegans |
mod-5(n822) I; mudIs1. Show Description
mudIs1 [tph-1p::ChR2::GFP + myo-3p::mCherry]. Worms stop moving when exposed to blue light. Reference: Pokala N & Glater EE. 2018. Journal of Undergraduate Neuroscience Education. 162(2): A152-A158.
|
|
| EEG98 |
C. elegans |
mudIs1. Show Description
mudIs1 [tph-1p::ChR2::GFP + myo-3p::mCherry]. Worms stop moving when exposed to blue light. Reference: Pokala N & Glater EE. 2018. Journal of Undergraduate Neuroscience Education. 162(2): A152-A158.
|
|
| JPS617 |
C. elegans |
vxIs591. Show Description
vxIs591 [tph-1p::GFP::unc-54 3'UTR]. GFP expression in all serotonergic neurons. Reference: Sae-Lee et al. G3 (Bethesda) 2020 Aug 5;10(8):2851-2861. PMID: 32580938
|
|
| JPS809 |
C. elegans |
vxSi808 X; vxIs591. Show Description
vxSi808 [rab-3p::APP::mCherry::unc-54 3'UTR] X. vxIs591 [tph-1p::GFP::unc-54 3'UTR]. Single-copy insertion of human APP transgene tagged with mCherry expressed throughout the nervous system, visible along ventral nerve cord, head, tail, and other neurons. GFP expression in all serotonergic neurons. References: Yi B, et al. 2017 J Neurochem 140(4): 561-575. PMID: 27926996. Mondal et al. 2018 ACS Chem Neurosci. DOI: 10.1021/acschemneuro.7b00428 PMID: 29426225
|
|
| JPS844 |
C. elegans |
vxIs824; vxIs591. Show Description
vxIs824 [rab-3p::ND18ApoE4::unc-54 3'UTR + myo-2p::mCherry::unc-54 3'UTR]. vxIs591 [tph-1p::GFP::unc-54 3'UTR]. Integrated transgene driving expression of human APOE4 throughout the nervous system; induces age-related neurodegeneration of HSNs and bag-of-worms in up to 60% of D3 adult worms. GFP expression in all serotonergic neurons. Reference: Sae-Lee et al. G3 (Bethesda) 2020 Aug 5;10(8):2851-2861. PMID: 32580938
|
|
| JPS845 |
C. elegans |
vxIs823 II; vxIs824; vxIs591. Show Description
vxIs823 [rab-3p::APP::mCherry::unc-54 3'UTR] II. vxIs824 [rab-3p::ND18ApoE4::unc-54 3'UTR + myo-2p::mCherry::unc-54 3'UTR]. vxIs591 [tph-1p::GFP::unc-54 3'UTR]. Integrated transgenes driving expression of human APOE4 and human APP throughout the nervous system; induces age-related neurodegeneration of HSNs and bag-of-worms in >60% of D3 adult worms. GFP expression in all serotonergic neurons. Reference: Sae-Lee et al. G3 (Bethesda) 2020 Aug 5;10(8):2851-2861. PMID: 32580938
|
|
| JVR406 |
C.elegans |
jerEx30. Show Description
jerEx30 [ddr-2p::BiFC1 (EGFH1-LINK-SYN) + tph-1p::BIFC2 (SYN-EGFH2) + rol-6(su1006)]. Pick Rollers to maintain. a-Synuclein BiFC transfer strain is a model to investigate neuron-to-neuron alpha-syn transfer. Reference: Tyson T, et al. Sci Rep. 2017 Aug 8;7(1):7506.
|
|
| LX960 |
C. elegans |
lin-15B&lin-15A(n765) X; vsIs97. Show Description
vsIs97 [tph-1p::DsRed2 + lin-15(+)]. DsRed2 expression in HSN, NSM, and associated processes. Additional background expression in tail and a pair of head neurons. NOTE: tph-1p::DsRed2 expression pattern is different than GFP expression driven by the same promoter [Koelle Lab].
|
|
| LX967 |
C. elegans |
lin-15B&lin-15A(n765) vsIs103 X. Show Description
vsIs103 [tph-1p::RFP + snb-1::GFP + lin-15(+)] X. RFP expression in HSN and NSM neurons.
|
|
| LX975 |
C. elegans |
vsIs13 IV; lin-15B&lin-15A(n765) X; vsIs97; vsIs100. Show Description
vsIs13 [lin-11::pes-10::GFP + lin-15(+)]. GFP expression in six VC neurons and posterior intestine. vsIs97 [tph-1p::DsRed2 + lin-15(+)]. DsRed2 expression in HSN, NSM, and associated processes. Additional background expression in tail and a pair of head neurons. NOTE: tph-1p::DsRed2 expression pattern is different than GFP expression driven by the same promoter [Koelle Lab]. vsIs100 [myo-3p::CFP + lin-15(+)]. CFP expression in VMs. Additional background expression seen as punctate nucleolar fluorescence along the ventral side of the worm (also present in wild-type).
|
|