| GG34 |
C. elegans |
emb-9(g34) III. Show Description
Temperature sensitive. Maintain at 15C. At 25C the animals die as pretzels; a few hatch and die as L1. Will grow at 20C.
|
|
| TG34 |
C. elegans |
gld-1(op236) I. Show Description
Hypersensitive to cep-1/p53 mediated apoptosis.
|
|
| BQ2 |
C. elegans |
eak-3(mg344) III. Show Description
Weak Hid. Eak.
|
|
| BQ3 |
C. elegans |
eak-4(mg348) IV. Show Description
Weak Hid. Eak.
|
|
| DG3408 |
C. elegans |
twk-1(tn1397) I. Show Description
Adult-onset uncoordinated or paralyzed. DG3408 was segregated from DG3095 [twk-1(tn1397) I; acy-4(ok1806) V]. Reference: Kim S, et al. 2012 Genetics
|
|
| DG3430 |
C. elegans |
sacy-1(tn1385) I. Show Description
Superficial wild type. DG3430 was segregated from DG3373 [sacy-1(tn1385) I; acy-4(ok1806) V]. Reference: Kim S, et al. 2012 Genetics
|
|
| DG3449 |
C. elegans |
sacy-1(tn1385) I; fog-2(oz40) V. Show Description
sacy-1(tn1385) partially suppresses fog-2(oz40) self-sterility. Reference: Kim S, et al. 2012 Genetics
|
|
| DG3485 |
C. elegans |
sacy-1(tm5503) I; tnEx159. Show Description
tnEx159 [sacy-1p::GFP::sacy-1 + unc-119(+)]. Pick wild-type to maintain. Transgene rescues sacy-1(tm5503) sterility. Reference: Kim S, et al. 2012 Genetics
|
|
| DG3492 |
C. elegans |
sacy-1(tm5503) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Segregates WT GFP+ heterozygotes, non-GFP sacy-1(tm5503) sterile animals, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Reference: Kim S, et al. 2012 Genetics
|
|
| FF451 |
C. elegans |
unc-32(f131) III. Show Description
Extreme coiler from L1 to adult. Hypomorph. f131/nDf17 is L1 lethal. Molecular lesion: g to a transition in splice donor site of exon 6 (g3485a) in ZK637.8 gene encoding a V-ATPase alpha subunit.
|
|
| IG341 |
C. elegans |
tpa-1(fr3) frIs7 IV. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Displays tpa-1 phenotypes (e.g. resistance to PMA). Isolated in a genetic screen for mutants failing to show an induction of nlp-29p::GFP reporter gene expression upon infection with the fungus Drechmeria coniospora (the Nipi phenotype). References: Pujol N, et al. Curr Biol. 2008 Apr 8;18(7):481-9. Ziegler K, et al. Cell Host Microbe. 2009 Apr 23;5(4):341-52.
|
|
| IG342 |
C. elegans |
frIs7 IV; nipi-3(fr4) X. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Slo, Sma, and Dpy at 25C. Reference: Pujol N, et al. Curr Biol. 2008 Apr 8;18(7):481-9.
|
|
| IG348 |
C. elegans |
fasn-1(fr8) I; frIs7 IV. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Constitutive expression of antimicrobial peptide nlp-29. Maintain under normal conditions. Reference: Lee KZ, et al. Virulence. 2010 May-Jun;1(3):113-22.
|
|
| LG340 |
C. elegans |
skn-1(zu135) IV/nT1 [qIs51] (IV;V); geEx1. Show Description
geEx1 [gpa-4p::skn-1b::GFP + rol-6(su1006)]. Rollers. Pick Rolling GFP+ and check for correct segregation of progeny to maintain. skn-1 heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP skn-1 homozygotes (early arrest). Homozygous nT1[qIs51] inviable. Reference: Nature (2007) 447(7144):545-9.
|
|
| LG344 |
C. elegans |
geIs8. Show Description
geIs8 [gpa-4p::skn-1b::GFP + rol-6(su1006)]. Reference: Nature (2007) 447(7144):545-9.
|
|
| LG345 |
C. elegans |
geIs9. Show Description
geIs9 [gpa-4p::skn-1b::GFP + rol-6(su1006)]. Reference: Nature (2007) 447(7144):545-9.
|
|
| LG348 |
C. elegans |
skn-1(zu135) IV/nT1 [qIs51] (IV;V); geIs9. Show Description
geIs9 [gpa-4p::skn-1b::GFP + rol-6(su1006)]. Rollers. Heterozygotes are rollers with pharyngeal GFP signal, and segregate GFP+ rollers, arrested nT1[qIs51] aneuploids, and non-GFP skn-1 homozygotes (early arrest). Homozygous nT1[qIs51] inviable. Pick GFP+ rollers and check for correct segregation of progeny to maintain. skn-1 mutants are maternal-effect lethal and must be maintained as balanced heterozygotes. Reference: Bishop & Guarente, Nature (2007) 447(7144):545-9.
|
|
| LG349 |
C. elegans |
geIs10. Show Description
geIs10 [ges-1p(long)::skn-1c::GFP + rol-6(su1006)]. Reference: Nature (2007) 447(7144):545-9.
|
|
| RG3400 |
C. elegans |
+/mT1 [umnIs52] II; rps-13(ve900[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 776 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 ve900 homozygotes (larval arrest), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: TCCAGGTTGGTGGAAGCTGACGCTTGGTCT; Right flanking sequence: ACCCATGGTTGATGCGGATTACCTGAAAGA. rps-13_C16A3.11 sgRNA A: TGTAGTATCTAGCCAAACGG; rps-13_C16A3.11 sgRNA B: CGCATGCACAATCCAGGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3401 |
C. elegans |
rps-10(ve901[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Egl, Emb. Deletion of 479 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 Egl adults that have no viable eggs or hatch a few sickly progeny (ve901 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: CATTTATTGTGGTGGTGGGGCTCCACGGCC; Right flanking sequence: AGGTACTCATAGATGAGCTTGGTGTGGCTT. rps-10 sgRNA A: GAATCCGGCTCTGTAGACTG; rps-10 sgRNA B: CAGTCACTCCCTCGTTGAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3402 |
C. elegans |
ZK993.5(ve902[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 3478 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAAGTGATAACGGGTGTGTTGCAATACCA ; Right flanking sequence: TATTTTAATCAGTTATGATAACTTTATGAT. ZK993.5 sgRNA A: CCAAGTAAGAATTATAGTGG; ZK993.5 sgRNA B: TATTAGCATATCCAACAGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3403 |
C. elegans |
ZK1240.9(ve903[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1214 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttgttgttcaatttatcgcgtgtgtggcaa ; Right flanking sequence: CGCAGGCATTGGCCAAGTTGAAAACTATCG. ZK1240.9 sgRNA A: atttccaaccttgccgaact; ZK1240.9 sgRNA B: ACGGCTTTATGAAGAAAAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3404 |
C. elegans |
pho-6(ve904[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1584 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGAGCATAAAGCAATGCAGAAAGTGTTCCA ; Right flanking sequence: GCTTGCATTATTATTAAATTCGCAGTTGAA. pho-6 sgRNA A: AATCTTCAATTCCAGCACGA; pho-6 sgRNA B: AATTTGGAGACACGGAGACC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3405 |
C. elegans |
F56A6.5(ve905[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1286 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCACAAGCACATTTAATTTTTCAAACCCCC ; Right flanking sequence: GCATTCAGTAACCTTCATCGCAAAAATAGT. F56A6.5 sgRNA A: GATTTCTTCATGACTCCTGA; F56A6.5 sgRNA B: AGTATATGCTATGATGAATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3406 |
C. elegans |
tbx-32(ve906[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1714 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATTGAAAAAGGAAAGAGGGGTGTGGTCAAT ; Right flanking sequence: GGATGACAACGCTATCTTTGAGCATTTTTT. tbx-32 sgRNA A: ATGGAGCATTATCAAGAAGG; tbx-32 sgRNA B: TCCACGTTTTCTTCAAGAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3407 |
C. elegans |
slc-17.5(ve907[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1674 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGTCCCCATTCTTCAGCAGTTCCAACAGTC ; Right flanking sequence: GATAGTGATAATCCGATGTGAGCTGTCATT. slc-17.5 sgRNA A: TTGTAATATGAGATCATGAG; slc-17.5 sgRNA B: ATGTATGTGCAACTCAACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3408 |
C. elegans |
+/nT1 [umnIs49] IV; C37C3.18(ve908[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 801 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ arrested larvae (ve908 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GGAGATCCAGTTGTGCATGTTCTTGTGCCC; Right flanking sequence: TATTTATCATTTGTAAGTACTAACAAGAGA. C37C3.18 sgRNA #1: AAATGGGCGCGAGTTTGTGT; C37C3.18 sgRNA #2: TCACGAGTCCGGTTGATATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3409 |
C. elegans |
tsp-20(ve909[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1448 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGTTGGGGCTATCACTCAAAGCACAGCCCT ; Right flanking sequence: AGGTATGAAATGAACAATTGACATTTTGAA. tsp-20 sgRNA A: CAAGAGTACACATCAACGGA; tsp-20 sgRNA B: AAACTATACTTACCACAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3410 |
C. elegans |
phf-34(ve910[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 2012 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTAACTATGAGAAATTATACTAAAATACAG ; Right flanking sequence: ATAGCAATCGAAATCACTATAAACTATTTA. phf-34 sgRNA A: ACAAACGTAGAGTGTAACGA; phf-34 sgRNA B: CGATTTTACACAGTTCGAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3412 |
C. elegans |
B0393.6(ve912[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 1655 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATTGGGAGTAATATGAAGAGTTCTGGAAG ; Right flanking sequence: CGGAAAAGTTGCGGAGCGAGCATCATATTC. B0393.6 sgRNA A: GTAAAATGAGGTCAAAATGA; B0393.6 sgRNA B: GGCACGGCCTGACAATATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3413 |
C. elegans |
ZC190.4(ve913[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence:AAAAAGTTGCGACTCCATAAATATGCTCCT ; Right flanking sequence:TTTCAATTTACAAAAATAGGTTAGCCATGT. ZC190.4 sgRNA #1:TATGTCATGTCTTGGAAGAG ZC190.4 sgRNA #2:GATGGGGTTATTACACAACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3414 |
C. elegans |
pipp-4P(ve914[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC1(s2023) [dpy-1(s2170) umnIs41] III. Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Homozygous ste. Deletion of 7788 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile GFP+ non-mKate2 (ve914 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: AAACCCCCTAAAATCTTCAAATTTTTCTGT; Right flanking sequence: TCAGGGTATATGCAAAAGATTCGAGCTCTC. Y71H2AM.2-sgRNA A: AGGAATGGACGTACCACCAG; Y71H2AM.2-sgRNA B: AAATTAGCGGGAAATTTGGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3415 |
C. elegans |
taf-8(ve915[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mIn1 [dpy-10(e128) umnIs43] II. Show Description
umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval arrest. Deletion of 1934 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve915 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: GAATGCTTCCTCAACACAATACATTTATTA ; Right flanking sequence: ACGACTACGGCAATTATGAGGATGAAGAGA. taf-8 sgRNA A: GGAGACCGACTATTGCAGGA; taf-8 sgRNA B: TGTCGCGTATCGGAGGGCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3416 |
C. elegans |
prx-2(ve916[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Maintain by picking wild-type GFP+ mKate2+. ve916 homozygotes are thin, slow-growing, lay small, slow-growing broods. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 thin slow growing hermaphrodites that can be maintained as a homozygous slow growing population (ve916 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Deletion of 1288 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCTTCCCAATAATACACTACACTGTACCCT; Right flanking sequence: TGGTCATTCTACAATAACTGAAAGCATTTT. prx-2 sgRNA A: AGGAATAGTGATAGTGGGGG; prx-2 sgRNA B: CTCTATTTCCTTCGATCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3417 |
C. elegans |
Y38C1AA.19(ve917[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 1665 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTCCTAAGTTATTTTCTTATCGGACTCCT ; Right flanking sequence: tttcggctgttttccggctggcagcgAGTT. Y38C1AA.19 sgRNA A: CATTTTATTGACGACTGATA; Y38C1AA.19 sgRNA B: aactatacgttgtcggctgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3418 |
C. elegans |
hpo-39(ve918[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 712 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tttctgttataagcgtcagctctcaactct ; Right flanking sequence: AAAGCGAAGAAATCCGTCTTCACCATAGGC. hpo-39 sgRNA A: ctcaggatagataacatcgt; hpo-39 sgRNA B: CCGGGAGATAAGGACCAGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3419 |
C. elegans |
T27F6.6(ve919[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 3262 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCAGAAAGTCGACATGGAGCCGGTTTTCCG ; Right flanking sequence: CGGAAGGCTTTGAAGGCCGCAAAACAGGCG. T27F6.6 sgRNA A: ACGCGGCGAATGATTCCCGG; T27F6.6 sgRNA B: TTATTGGCTTAACGTTGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3420 |
C. elegans |
Y48G1C.6(ve920[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1281 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GATCAGAATCTGATTCGTGGCCGTTTTCCT ; Right flanking sequence: TGGAGACAGCAAATTGGCACACACGCAGAG. Y48G1C.6 sgRNA A: CCGCCAGAACTTTAGGAACT; Y48G1C.6 sgRNA B: GAACGAAGGGGCAAGACTAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3421 |
C. elegans |
F44E5.4 & F44E5.5(ve921[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 4584 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence:AATTAATCAACTTCCTCAACAGTAGGTCCT ; Right flanking sequence:AATGTTGTTCTAATAAATTTACAAAAATCT. sgRNA: AATCCTAACAATTATCCACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3422 |
C. elegans |
clec-86(ve922[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 512 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: cttgtcgcgcttttgtgttttgtgtCACCA ; Right flanking sequence: CCCACCATGTCCATCTTGTTCTAAATAACT. clec-86 sgRNA A: GTATCTCCAGGAAGACAATT; clec-86 sgRNA B: CATGTGTACGATCCTCCAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3423 |
C. elegans |
F25B4.7(ve923[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1194 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGTTCACCAGGGCTCCATGGAAAAATGCCT ; Right flanking sequence: CATCTCTCGTTTTTATATAATTTTCACTAC. F25B4.7 sgRNA A: TTACACGAAGGAAGGACCCA; F25B4.7 sgRNA B: TCGGTGTACACAGCAGTTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3424 |
C. elegans |
clec-53(ve924[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1852 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATTTAGTGAAGTGGAGCAATTTTACAAAGG ; Right flanking sequence: AGTGGTCGGAGCATTTGACTCGACTACTGC. clec-53 sgRNA A: AAAGCTCTTTGATCGTCTTG; clec-53 sgRNA B: GATTCTTGCTCTGTGCCTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3425 |
C. elegans |
T23B12.5(ve925[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1235 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTCCCGTTTTGTTGGCAAATGAGTATCCG ; Right flanking sequence: TGTAGGCATTCAAAACAAGTATCGATAGAA. T23B12.5 sgRNA #1: TGTTTTCCAATCCTTCTCAT; T23B12.5 sgRNA #2: TATCGCTTTGAAGCTTCACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3426 |
C. elegans |
gsto-1(ve926[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 1355 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGACTGGTTTTAATATCAAAGGCCCAAATC ; Right flanking sequence: AGGTTCCGCATCTCCTTTTCGAATTGCTTT. gsto-1 sgRNA A: ATAATTCAATTCCTGGTGCG; gsto-1 sgRNA B: AAAGATCCCTTTGATAGCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3427 |
C. elegans |
alkb-7(ve927[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1410 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCTAGGCATCAGAAGATCCATAATCAGTT ; Right flanking sequence: AAATTATGAAATTTTATCAAATGTTGCAGA. alkb-7 sgRNA A: CATCCTTCTGATCCTTGTGC; alkb-7 sgRNA B: GGAACTGTGGCCGAAGGATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3428 |
C. elegans |
cal-1(ve928[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1987 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTTACGAACTCTTCGTAATCAATTTCCCC ; Right flanking sequence: CGGTTTGCTTACCATATCTCTGGCGAGTCG. cal-1 sgRNA A: AAGTTGATGTGGATGGAGAC; cal-1 sgRNA B: TTCATGCTCCATGTTAGTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3430 |
C. elegans |
R02F2.1(ve930[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 4303 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCATCTTCTACTGTCATTTCCAAATTCCCA ; Right flanking sequence: CTCTCATACTAATACAAATTCTATATATAT. R02F2.1 sgRNA A: CTCGTCTTCGTTCTGTAACA; R02F2.1 sgRNA B: AGATGGTGTGTGGGGGAATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3431 |
C. elegans |
agt-1(ve931[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 840 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTGAAAATCTGAGTTCAGCGCCTTCTGCCT ; Right flanking sequence: CGGATGATCATTTCTACTTTAATAAAATTG. agt-1 sgRNA A: GAAGAAGCGTCGCCTATTGC; agt-1 sgRNA B: CGACTTCATAGACGCACTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3432 |
C. elegans |
alh-9(ve932[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 1769 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tcagttttcgtcgtcataaacaatctgccc ; Right flanking sequence: TGGAGGTCGCGAATCAGGATCCGACTCCTG. alh-9 sgRNA A: gtatgggcggagcgagacac; alh-9 sgRNA B: GGCGGAGAAAAGGAGACCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3433 |
C. elegans |
gst-22(ve933[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1174 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGCATCATTATTTTTTCTTTCACaaaaaaa ; Right flanking sequence: TTTGTAAGAGGGCATATTTTATTTGTGAAG. gst-22 sgRNA A: aCAATTCACACAAGCGTCAC; gst-22 sgRNA B: CTGACTTACTTTGATGCTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|