| DG3408 |
C. elegans |
twk-1(tn1397) I. Show Description
Adult-onset uncoordinated or paralyzed. DG3408 was segregated from DG3095 [twk-1(tn1397) I; acy-4(ok1806) V]. Reference: Kim S, et al. 2012 Genetics
|
|
| DG3095 |
C. elegans |
twk-1(tn1397) I; acy-4(ok1806) V. Show Description
twk-1(tn1397) suppresses acy-4(ok1806) sterility. acy-4(ok1806) suppresses twk-1(tn1397) adult-onset uncoordinated or paralyzed phenotype. Reference: Kim S, et al. 2012 Genetics
|
|
| AML580 |
C. elegans |
wtfIs491. Show Description
wtfIs491 [inx-1p::twk-18(gf)::mCherry + unc-122p::RFP]. AIB(-) activated potassium channel. Expression of twk-18 gain-of-function mutant in AIB neurons causes permanent inhibition. RFP expression in coelomocytes. Reference: Chen KS, et al. Olfactory learning alters navigation strategies and behavioral variability in C. elegans. ArXiv, Feb 23:arXiv:2311.07117v2. PMID: 38013890.
|
|
| CB3533 |
C. elegans |
+/szT1 [lon-2(e678)] I; twk-18(e1913)/szT1 X. Show Description
Heterozygotes are Unc and segregate Unc, dead eggs, and Lon males. e1913 is a dominant Unc and recessive lethal. Maintain by picking Unc. e1913 previously called unc-110.
|
|
| CB4461 |
C. elegans |
twk-18(e1913e2383) X. Show Description
Wild type. previously called unc-110.
|
|
| MSB555 |
C elegans |
twk-16(syb2541[wrmScarlet::degron::twk-16]) X. Show Description
wrmScarlet::degron tag inserted into the N-terminus of the endogenous twk-16 locus using CRISPR. wScarlet::TWK-16 expression in DVA and some neurons around the nerve ring. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987
|
|
| MT3840 |
C. elegans |
unc-93(e1500n1415) dpy-17(e164) III; twk-18(e1913)/+ X. Show Description
Pick DpyUnc worms to maintain, as e1913 is a dominant Unc and a recessive lethal. Actually, the Uncs are not very Dpy, so pick non-Dpy-looking animals that don't move well. e1913 previously called unc-110.
|
|
| OH10722 |
C. elegans |
pha-1(e2123) III; otEx4804. Show Description
otEx4804 [twk-13p(2.5kb promoter)::DsRed2 + pha-1(+)]. Maintain at 25C. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989.
|
|
| PHX2193 |
C elegans |
flp-11(syb2193[flp-11::SL2::mKate2::linker::twk-18(e1913)]) X. Show Description
twk-18(e1913) was knocked into the endogenous locus of flp-11 to express a potassium channel in RIS that causes very strong inactivation of RIS. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665.
|
|
| TN110 |
C. elegans |
twk-18(cn110) X. Show Description
Semi-dominant. Reversible paralysis. Straight and rigid body form at the restrictive temperature (30C); recovers to WT when the temperature is lowered. Previously called mah-2(cn110) and unc-110(cn110). See WBPaper00004376.
|
|
| VC3930 |
C. elegans |
twk-18(gk5009[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 3495 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCATTCTGGGCGAATTTATGATTGCCAATA; Right flanking sequence: GAAGTTGTCCGTGTTGAGCATTTCAATCAC. See WormBase Variation gk5009 for details.
|
|