Search Strains

Internal tag of EGL-19 at N-terminal side of exon 3 via CRISPR/Cas9 knock-in of mScarlet at egl-19 locus. Tags isoforms a and b. Insertion verified by PCR and fluorescence. Left flank: 5' ttatttgaatgagcaaaaaataaatttcag 3'; Right flank: 5' GCCGCAGTGGCAGCTTCATCATCACAAGAT 3’ (1 silent mutation); gRNA: TTGTGATGATGAAGCTGCCA; Cas9/sgRNA plasmid: pGLOW69; mScarlet^SEC^3xMyc plasmid: pGLOW60; SEC insertion allele strain (balanced): GLW52.

N-terminal tag of SOD-5 via CRISPR/Cas9 knock-in of mScarlet at sod-5 locus. Insertion verified by PCR and fluorescence. Left flank: 5' tgtgctaacgaaaattttactaaaaggaaa 3'; Right flank: 5' ATGGATATTCTCTCTGATATTGCAAATGCC 3’ (1 silent mutation); sgRNA: tacCTGTGGAAGAACGGCAT; Cas9/sgRNA plasmid: pGLOW122; mScarlet^SEC^3xMyc plasmid: pGLOW129; SEC insertion allele strain: GLW78.

N-terminal tag of PQE-1 via CRISPR/Cas9 knock-in of mScarlet at pqe-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ CCAGATGCGAAAGCGAACAG 3’ ; rev – 5’ TGTACTTACCGGAATCGGCG 3’. Left flank: 5' ttaataatcattccagcaagtatctcagcc 3'; Right flank: 5' ATGTTTAATGGCGGCTATGGATCTGGAAAC 3’; sgRNA: atctcagccATGTTTAATGG; Cas9/sgRNA plasmid: pGLOW143; mScarlet^SEC^3xMyc plasmid: pGLOW142; SEC insertion allele strain: GLW84.

N-terminal tag of UBQL-1 via CRISPR/Cas9 knock-in of mScarlet at ubql-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ AGGGCGAGAGATTATCGGGA 3’; rev – 5’ CGGATCGTTGAGAATGTGTCC 3’. Left flank: 5' gtcggttttttaatatttctcaaatttaag 3'; Right flank: 5' ATGGCTACAGAGAGTGCACTCATCAAAGTTCACGTGAAATCACCCT 3’ (7 silent mutations); sgRNA: TCAACGTCATACTTGTTCGA; Cas9/sgRNA plasmid: pGLOW134; mScarlet^SEC^3xMyc plasmid: pGLOW145; SEC insertion allele strain: GLW88.

C-terminal tag of HRPA-1 via CRISPR/Cas9 knock-in of mScarlet at hrpa-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ GTCTCCACCAAACGCCTGTA 3’ ; rev – 5’ CTAGCCTGTGTCCCATCAGC 3’. Left flank: 5' AATGGGCCCACGCCCAGGGAGGAAACAGAAACTAT 3' (5 silent mutations); Right flank: 5' TAAattaattccttaagcccctctaagtgt 3’; sgRNA: CAGTGGGCTCATGCTCAAGG; Cas9/sgRNA plasmid: pGLOW144; mScarlet^SEC^3xMyc plasmid: pGLOW153; SEC insertion allele strain: GLW90.

N-terminal tag of CLIC-1 via CRISPR/Cas9 knock-in of mScarlet at clic-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ CTCGTACCAATCGTCCGCAA 3’; rev – 5’ CCATCTTGTTGCTTGGCGAAA 3’. Left flank: 5' ccagggtataaaacacaaaaaaactacaaa 3'; Right flank: 5' ATGTCGGATCCAGTCGCGGATTTTTTGGCT 3’ (1 silent mutation); sgRNA: ctacaaaATGTCGGATCCAG; Cas9/sgRNA plasmid: pGLOW128; mScarlet^SEC^3xMyc plasmid: pGLOW156; SEC insertion allele strain: GLW92.

cpIs53 [mex-5p::GFP-C1::PLC(delta)-PH::tbb-2 3'UTR + unc-119 (+)] II. Reporter labels plasma membrane in early embryo. Transgene construct consisted of a germline promoter sequence (mex-5) driving the expression of a fluorescent protein fused to the N-terminus of the pleckstrin homology domain from phospholipase C-(delta)1 (PH domain) and a 2x Flag epitope tag. Reference: Heppert JK, et al. Mol Biol Cell. 2016 Nov 7;27(22):3385-3394.

cpIs55 [mex-5p::mCherry-C1::PLC(delta)-PH::tbb-2 3'UTR + unc-119 (+)] II. Reporter labels plasma membrane in early embryo. Transgene construct consisted of a germline promoter sequence (mex-5) driving the expression of a fluorescent protein fused to the N-terminus of the pleckstrin homology domain from phospholipase C-(delta)1 (PH domain) and a 2x Flag epitope tag. Reference: Heppert JK, et al. Mol Biol Cell. 2016 Nov 7;27(22):3385-3394.

mNG:GEX-3 endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).

mNG::MEX-5 endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).

mNG::OMA-2 endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).

mNG::RAP-1 endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP fusion. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

mNG::PAR-2 endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

mNG reporter inserted into endogenous unc-94 locus, specifically tagging the UNC-94A isoform. Reference: Zhang P, et al. 2023 Sep 4;222(9):e202302102. doi: 10.1083/jcb.202302102.

mNG reporter inserted into endogenous unc-94b locus, specifically tagging the UNC-94B isoform. Reference: Zhang P, et al. 2023 Sep 4;222(9):e202302102. doi: 10.1083/jcb.202302102. PMID: 37351566.

mNG reporter inserted into endogenous unc-94b locus. m-Scarlet-I reporter inserted into endogenous cap-1 locus. Reference: Zhang P, et al. 2023 Sep 4;222(9):e202302102. doi: 10.1083/jcb.202302102. PMID: 37351566.

mNG reporter inserted into endogenous fli-1 locus. Reference: Zhang P, et al. 2023 Sep 4;222(9):e202302102. doi: 10.1083/jcb.202302102. PMID: 37351566.

mNG reporter inserted into endogenous eps-8 locus. Reference: Zhang P, et al. 2023 Sep 4;222(9):e202302102. doi: 10.1083/jcb.202302102. PMID: 37351566..

jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1514 [LoxP::RMCE mec-4p::GFP-C1::FRT3] I. RMCE insertion of mec-4 promoter driving GFP-C1. Reference: Nonet ML. Genetics. 2020.

jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1518 [LoxP::UAS 11X::(delta)pes-10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1515 [LoxP::mec-4p::GAL4-QF::FRT3] IV. RMCE derived single copy UAS GFP-C1 reporter line on Chr I and RMCE derived single copy mec-4p GAL-4-QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.

jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1527 [LoxP::lexO 5X::(delta)pes-10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1549 [LoxP::mec-4p::lexA-L-QF::FRT-3] IV. RMCE derived single copy lexO GFP-C1 reporter line on Chr I and RMCE derived single copy mec-4p lexA-L-QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.

jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1517 [LoxP::QUAS 5X::(delta)pes-10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1551 [LoxP::mec-4p::QF::FRT3] IV. RMCE derived single copy QUAS GFP-C1 reporter line on Chr I and RMCE derived single copy mec-4p QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.

jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1543 [LoxP::tetO 7X::(delta)mec-7p::(delta)mec-7p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1548 [LoxP::mec-4p::rtetR-L-QF::FRT3] IV. RMCE derived single copy tetO GFP-C1 reporter line on Chr I and RMCE derived single copy tet ON mec-4p rtetR-L-QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.

jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1517 [LoxP::QUAS 5X::(delta)pes-10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1554 [LoxP::mec-4p::QF2::FRT3] IV. RMCE derived single copy QUAS GFP-C1 reporter line on Chr I and RMCE derived single copy mec-4p QF2 driver on Chr IV. Reference: Nonet ML. Genetics. 2020.

jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1519 [LoxP::tetO 7X:: (delta)pes10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSI1560 [LoxP::mec-4p::tetR-L-QF::FRT3] IV.RMCE derived single copy tetO GFP-C1 reporter line on Chr I and RMCE derived single copy tet OFF mec-4p tetR-L-QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.