Search Strains

popl-5 [S99I]/tmC29 III. Variant edit. Lethal mutation balanced by tmC29. Balancer marked with myo-2p::GFP. Heterozygotes are WT with pharyngeal GFP, and segregate GFP+ heterozygotes, non-GFP popl-5 [S99I] homozygotes (larval lethal), and Unc GFP+ tmC29 homozygotes. Pick fertile wild-type GFP+ to maintain. NOTE: udn113 homozygotes are partially L3 larval lethal: some homozygotes can develop into sterile adults with protruding vulvae. Pick fertile GFP+ to maintain. AvaII site added in S99I allele for ease of genotyping. Reference: Huang et al. 2022. PMID: 35121658

jsSi1606 [loxP::unc-116(+)::FRT3] II. Single copy unc-116(+) insertion at the standard Chr II ttTi5605 mosSCI site. jsSi1579 is an RMCE landing pad inserted at a sgRNA site 45 bp from the ttTi5605 insertion site. It contains an rpl-28p::GFP reporter flanked by FRT and FRT3 sites and a loxP site (for more details about landing pads, see Nonet, 2020.Genetics or visit https://sites.wustl.edu/nonetlab/rmce/).

leEx1423 [mxl-2::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

leEx1432 [hlh-10::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

leEx1435 contains [hnd-1::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.

leEx1439 [mxl-3::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

leEx1444 [hlh-29::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

leEx1447 contains [hif-1::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.

leEx1531 contains [mml-1::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.

leEx1533 contains [hlh-3::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.

leEx1546 [hlh-2::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

leEx1556 contains [hlh-12::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.

leEx1566 [lin-32::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

leEx1583 contains [hlh-4::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.

leEx1601 contains [hlh-8::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.

leEx1606 contains [aha-1::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.

leEx1692 contains [hlh-34::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.

leEx1709 [ahr-1::GFP + unc-119(+)]. Superficially wild-type. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

leEx1713 [hlh-17::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

csEx52[hsp::lin-45AA + sur-5::GFP]. Maintain by picking GFP+.

csEx53[hsp::lin-45AA + sur-5::GFP]. Maintain by picking GFP+.

csEx63 [(pMS88) hsp16-41::torso^4021-Draf + (pTG96) sur-5::GFP]. Pick GFP+ to maintain. Muv phenotype in GFP+ after heat shock during larval stage. References: Kao G, et al. Development. 2004 Feb;131(4):755-65. Rocheleau CE, et al. Proc Natl Acad Sci U S A. 2005 Aug 16;102(33):11757-62.

lin-3(-) heterozygous balanced strain containing single copy MOS-mediated insertion of csSi1 transgene encoding lin-3S (short) splice isoform, expressed under control of the lin-3 promoter. The transgene rescues lethal and Vulvaless phenotypes (but not sterility) of lin-3 mutants, which can be recognized by absence of myo-2::GFP from the nT1 balancer. Pick GFP+ to maintain.

lin-3(-) heterozygous balanced strain containing single copy MOS-mediated insertion of csSi1 transgene encoding lin-3L (long) splice isoform, expressed under control of the lin-3 promoter. The transgene partially rescues lethal and Vulvaless phenotypes (but not sterility) of lin-3 mutants, which can be recognized by absence of myo-2::GFP from the nT1 balancer. Pick GFP+ to maintain.

lin-3(-) heterozygous balanced strain containing single copy MOS-mediated insertion of csSi1 transgene encoding lin-3XL (extra long) splice isoform, expressed under control of the lin-3 promoter. The transgene partially rescues lethality (but not Vulvaless or sterile phenotypes) of lin-3 mutants, which can be recognized by absence of myo-2::GFP from the nT1 balancer. Pick GFP+ to maintain.

Him strain. Superficially wild-type. References: Portman and Emmons Dev Bio (2004) & Miller and Prtman Mod & Mech (2010).

Him strain. Superficially wild-type. Males have mating (response) defect but are fertile; otherwise superficially wild-type. Reference: Miller and Prtman Mod & Mech (2010).

Benzaldehyde/starvation learning defective. mm200 is a single base pair change resulting in an L199F substitution. Reference: Merritt DM, et al. A Novel Memory Type in C. elegans Exhibits Post-Training Consolidation. bioRxiv 2023.02.22.529281. doi: https://doi.org/10.1101/2023.02.22.529281.

Double mutant with loss of function in both CREB genes. Derived by crossing parental strains YT17 crh-1(tz2) and VC3149 crh-2(gk3293). Reference: Merritt DM, et al. A Novel Memory Type in C. elegans Exhibits Post-Training Consolidation. bioRxiv 2023.02.22.529281. doi: https://doi.org/10.1101/2023.02.22.529281.

narSi2 [mex-5p::GFP::mpk-1B + unc-119(+)] II. narEx29 [sur-5p::GFP::mpk-1A + myo-3p::RFP]. mpk-1(-) strain with germline MPK-1B rescued by single-copy insertion and somatic MPK-1A rescued by an extrachromosomal array. Pick RFP+ to maintain; narEx29 rescues mpk-1 so array should be stable. Transgene uses codon-optimized version of GFP. Reference: Robinson-Thiewes et al. Cell Reports, In Press.

narSi2 [mex-5p::GFP::mpk-1B + unc-119(+)] II. mpk-1(-) strain with germline-specific expression of GFP::MPK-1B. GFP::MPK-1B rescues fertility but the animals are still Vulvaless. Transgene uses codon-optimized version of GFP. Reference: Robinson-Thiewes et al. Cell Reports, In Press.

mScarlet-I-GLO and Myc tags inserted into endogenous par-3 locus. mScarlet-I-GLO is a germline-optimized variant coded to be less prone to silencing in the germline. Reference: Chang Y & Dickinson DJ. Cell Rep. 2022 Apr 12;39(2):110652. doi: 10.1016/j.celrep.2022.110652. PMID: 35417695.

Heterozygotes are WT and segregate WT and Uncs. 1/3 of the WT are zhp-3(jf61::unc-119+) homozygotes and these lay mostly dead eggs.

jfIs2[pie-promoter::GFP::zhp-3 + unc-119(+)]. Maintain at 15C.

jnSi12 [peel-1p::htas-1::mCherry::tbb-2 3'UTR + Cbr-unc-119(+)] II. ezIs2 [fkh-6::GFP + unc-119(+)] III. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP expression in spermatheca. mCherry expression in germline nuclei. UX993 sperm have increased mCherry intensity compared to that of its parent strains. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

Homozygous lethal mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sv42 homozygotes (scrawny, arrests late larva or sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

gkDf2. Multiple genes deleted. Deletion extents determined by oligo array CGH. Deletion size: ~44kb. Deletion left flank: TTAGTAAGCCGGAAAATGGATTTCGCTTTTCTCCTATTGAGAAACCTAAA. Deletion right flank: CTACCTTTCAAAATGAATAGCAACCACTTTTTCGACGAAGAAATGTTCGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T28D9. Unc. External left primer: CATTTCGGAACGTTTCCATC. External right primer: TCTGCTTCGTACTTTGCTGC. External WT amplicon: 1121 bp. Deletion size: 436 bp. Deletion left flank: TTTTTTACGTGAATCTTTTTTTTTTCAGAA. Deletion right flank: CAAGTTGTGAATTTTCGAACATCCGTCGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K08F8.6. Unc. External left primer: TCAATGCCTGGAGATGATGA. External right primer: CCCGCCTTCTTTATCTGTTG. External WT amplicon: 434 bp. This strain carries a point mutation in K08F8.6. The mutation is gk908, which is a G->A mutation at K08F8 coordinate 36647 (flanking sequences AATGGTTGAAGAAAGCAAGAAGGAAAGTTA and CAAACAACAGATAAAGAAGGCGGGGCAGTA). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries a homozygous deletion in M01D1.2 (gk1188), identified by CGH (Comparative Genome Hybridization). Minimum deletion size: 345 bp; maximum size 5952 bp. Left flanking probe: TGAAATCGGTGAGCTTTTGGTCTGGGTAAGCTCTCAGGAGGAGCCAGCCT. Right flanking probe: CTATTCAACCCCCATGCGTTGGATGAAGCCTTCCCAATGTCCAACCTTTA. Left deleted probe: AAGCCCTGCGATCACTGGTAAGCTCCTGATCACCCTATTACTTGCACAGT. Right deleted probe: AATCGCAGAGATTGTCAGCGACTTGAAGCTCGGCGGATTGGACAGGCCGT. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

R11G1.6. External left primer: GAGACGTTGAAGTACGCGCT. External right primer: CCGAAAATTCGAAAGCGTAA. Internal left primer: TTACCCAGAGACCGAACTGC. Internal right primer: CTTCATCGCCCTCTTTCCTT. Internal WT amplicon: 838 bp. Deletion size: approximately 200 bp. This deletion was identified by comparative genome hybridization (CGH) and confirmed by PCR, but was not sequenced. Left flanking probe: AAAGGATCACCCACAGCATCTCTCCAAACAGCCAACCCAAAACTAAAATT. Left deleted probe: AAAACAATGAGTACGGATTCAAAAATAAAACCTTGTAGGAAACTTGTGTA. Right deleted probe: GGATTCGATGGCATCTGTATAGAGTTGAATGGCATAATTATAGGCATTTA. Right flanking probe: GAAGCGATTCGAATCGTTCTCCCGACAACATCTTAGGAACAACGGCCTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries a homozygous deletion in F19C6.1 (gk1192), identified by CGH (Comparative Genome Hybridization), which can be detected by PCR with the following primers. External left primer: CGAACTCGCCGTTCTACTTC. External right primer: GTTTTAGCGGCTTCAACTGC. Internal left primer: CGTCCCTTGATTGGTTCATT. Internal right primer: GATTCTCATTGGCAGACGGT. Internal WT amplicon: 3924 bp. Approximate deletion size: 2575 bp. The deletion was confirmed by PCR, but was not sequenced. Left flanking CGH probe: TTCGTTCAAGCTTAATGTTTCAGCATGCCTCTTCTTGACTCGCTTCTTTT. Left deleted CGH probe: TCCGGTACCAATTGTCGACTTGCTACCATTTTACGACCGCACAACTAAAA. Right deleted CGH probe: TAGTGAGGGAACTGTAGATAATTCTTCCACTTTTTGCTTTTTCCTTTCTT. Right flanking CGH probe: TACCGTATTGGCAACGATATTTTCAATCTCCATGGTCCTATCGTGGCTGA. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries a homozygous deletion in F42A10.1 (gk1194), identified by CGH (Comparative Genome Hybridization), which can be detected by PCR with the following primers. External left primer: TGGCTTTGCAATCTGTTGAG. External right primer: ATGCTTGCTCGTTGTCTGTG. Internal left primer: ACTTGATTCTTGACGAGCCT. Internal right primer: CAACTGATAAGAGTGGTTCGCA. Internal WT amplicon: 906 bp. Maximum deletion size: 137 bp. Minimum deletion size: 101 bp. The deletion was confirmed by PCR, but was not sequenced. Left flanking probe: TTTTGTTTCGCATTCGGTTGTTTCCCATATTTCACCCAGTTTCCACGTTT. Left deleted probe: TATTAAATTGTTCACTTCAAAATTTAAGTATGAGTGAGAGCTCTAGCCTG. Right deleted probe: AAATAATGCAAAGGTCTTCCTTGCTCGGGTCATCATGAAGAAGATACTCG. Right flanking probe: GGGTCATCATGAAGAAGATACTCGAGTTGGTAAGGCTTATCGTTCTGAAA. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries homozygous deletions in C26C6.1 (gk1195) and F14D12.6 (gk1196), identified by CGH (Comparative Genome Hybridization), and confirmed by PCR but not sequenced. The deletions can be detected by the following primers. gk1195: External left primer: ACGGAAGTTCTCAAAGCGAA. External right primer: TCGTCTTCAGCAGTGAATGG. Internal left primer: GCAGGCTCTTCAATGTACGA. Internal right primer: TCTCGGAAAGGCGTAAGAAA. Internal WT amplicon: 506 bp. Approximate deletion size: 100 bp. gk1196: External left primer: CCGGGAAATCACAGCACTAT. External right primer: TACGAATGCAGCGACAGAAC. Internal left primer: AGGATTCACGACGAATGTCC. Internal right primer: CTTCTCGGTAACTTCGCCAC. Internal WT amplicon: 1785 bp. Approximate deletion size: 900 bp. gk1195 left flanking probe: GATGAGGAGGGAGGAAACAAACCGGCGATGGTGAAAAGACATGTAGGATA. gk1195 left deleted probe: TTTCTGCATGTTATTAATTAAATTCTTTTCAGGAAAGCGAAGTCGAAATG. gk1195 right deleted probe: ATATGTGGCACCATGTTACGCATACGTTTCCCGATCTGACGAGAAGAAAA. gk1195 right flanking probe: ACGCATACGTTTCCCGATCTGACGAGAAGAAAACTCCTCTTCACATTTTC. gk1196 left flanking probe: AGCAACCGACATCTGGACGACACGTCGCCGTAGCTCCTTTTGAGTGACGT. gk1196 left deleted probe: GCTCAAATTGCAAACTAGTTTTCATTTGTAGAACTCCATGAGTGGATGAA. gk1196 right deleted probe: TCTCTGTTTCCTTCAGTCGCTGCCTACTATGACGGATGGTTATACTGTAG. gk1196 right flanking probe: CTATGACGGATGGTTATACTGTAGATTTTGGCATAAACGATGATGAGAAT. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Y119C1B.8. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk425 homozygotes (sterile with spiky vulva). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K11E8.1c. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W06H3.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y67D8C.5. Superficially wild type. External left primer: TTCTCCTGTGACAGCATTCG. External right primer: ATCTCAACAAAAGCCCGATG. Internal left primer: AACGACAGTGTGCGAACTTG. Internal right primer: TGTGCTGGGAGTATGAGCTG. Internal WT amplicon: 3242 bp. Deletion size: 1637 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807