| ML653 |
C. elegans |
vab-10(mc44)/unc-75(e950) unc-101(m1) I. Show Description
Heterozygotes are WT and segregate WT, Uncs and dead eggs and larvae with severe body morphology defects that do not develop beyond the L2 stage. A few very rare mc44 larvae reach adulthood but they become sterile. mc 44 is a deletion affecting the downstream transcription unit of vab-10 named vab-10b. Fails to complement the vab-10 null reference allele vab-10(h1356), but complements the vab-10a alleles vab-10a(e698) and vab-10a(ju281).
|
|
| ML855 |
C. elegans |
+/szT1 [lon-2(e678)] I; ppk-3(mc46)/szT1 X. Show Description
Heterozygotes are WT and segregate WT, arrested szT1 aneuploids, Lon males, mc46 hemizygotes (WT males) and mc46 homozygotes. mc46 is a deletion that results in homozygotes which show enlarged vacuoles (late endosomes and lysosomes) and lay eggs with enlarged vacuoles that die at different stages of embyronic development.
|
|
| MLC113 |
C. elegans |
ttTi5606 mir-236(luc2[unc-119(+)]) II; unc-119(ed3) III. Show Description
Superficially wild-type. CRISPR/Cas9-engineered mir-236 deletion allele; miRNA hairpin replaced by unc-119.
|
|
| MLC1384 |
C. elegans |
mir-1(luc108) I. Show Description
Superficially wild-type. CRISPR/Cas9-engineered mir-1 deletion allele (breakpoints: gcagaaaattactcaccattaaaacactaccacc
|
|
| MLC1776 |
C. elegans |
tbx-43(luc131) III. Show Description
Wild-type morphology. CRISPR/Cas9 engineered 952 bp deletion of the tbx-43 locus. Flanking sequence: aattagtttttagctccagaagtcggggccgcgccacgttgcatgctcgg / ggcgcttatggaaaaatcattgtggcgggaattcgattcgcagtgtaatg Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421
|
|
| MLC1946 |
C. elegans |
tbx-11(luc144) III. Show Description
Wild-type morphology. CRISPR/Cas9 engineered 1.3 kb deletion of the tbx-11 locus. Flanking sequence: aaaaataacaaaataacaaggaatgagaagggaaaacaggaaaaatacac / ttgccacgtgttgggcgggaaaacgcgtagtcatccggcaggtgtaacct Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421
|
|
| MLC2230 |
C. elegans |
vha-1(luc161) III/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP, arrested hT2 aneuploids, and non-GFP luc161 homozygotes (embryonic lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. vha-1(luc161) is a 454 bp deletion removing most of the coding sequence. Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
|
|
| MLC2312 |
C. elegans |
che-1(luc174) I. Show Description
Wild-type morphology. CRISPR/Cas9 engineered 3.38 kB deletion of the che-1 locus. Flank: caaaaacatcacaaaaataa // tataatttactgatacaata Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421
|
|
| MLC237 |
C. elegans |
mir-791(luc39) X. Show Description
luc39 is a deletion of mir-791. mir-791(luc39) mutants show a decreased turning and reversal rate compared to N2 animals under conditions where the CO2 concentration is gradually increased from 0-5%. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047.
|
|
| MLC239 |
C. elegans |
mir-790(luc40) IV. Show Description
luc40 is a deletion of mir-790. luc40 mutants respond normally to CO2 as compared to mir-791(lf) animals. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047.
|
|
| MLC2543 |
C. elegans |
dct-1(luc194) X. Show Description
CRISPR/Cas9-engineered deletion removes the entire dct-1 coding sequence. Homozygote mutant animals are viable and have normal morphology. Outer left sequence: gtttcagagacgggtctttcctaaca Outer right sequence: ttccaaacaaaaattttaacgttcgactta sgRNA1: ACAGCAGACGGAGCAGTCAT sgRNA2: GTACAGTGAAATGAGGTAAG Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
|
|
| MLC349 |
C. elegans |
ttTi5606 II; unc-119(ed3) III; mir-1820(luc16[unc-119(+)]) IV. Show Description
Superficially wild-type. CRISPR/Cas9-engineered mir-1820 deletion allele; miRNA hairpin replaced by unc-119.
|
|
| MLC524 |
C. elegans |
unc-2(luc27) X. Show Description
luc27 is a 300 bp deletion in the unc-2 3'UTR. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047.
|
|
| MLC610 |
C. elegans |
cah-3(luc28[3' UTRmutant, delta mir-791 binding sites]) Show Description
luc28 removes mir-791 binding sites in the cah-3 3'UTR. luc28 worms show less response towards a gradual increase in CO2 concentration from 0-5% as compared to N2 animals. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047.
|
|
| MLC618 |
C. elegans |
hbl-1(luc32) X. Show Description
luc32 is a 670 bp deletion in the hbl-1 3'UTR. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047.
|
|
| MLC698 |
C. elegans |
mir-255(luc38) V. Show Description
Superficially wild-type. CRISPR/Cas9-engineered mir-255 deletion allele removes the hairpin (breakpoints: aaactttcgttgctgcgaaat...ccattcaattaatttcccgcatttcttaatttttgagctttttctt).
|
|
| MN1 |
C. elegans |
ppt-1(gk139) V. Show Description
Delay in L4 to adult transition. Abnormal mitochondrial morphology.
|
|
| MT10549 |
C. elegans |
tdc-1(n3421) II. Show Description
Forages while backing. Deletion in L-aromatic amino acid decarboxylase with homology to histidine decarboxylase. Reference: Alkema M, et al. Neuron. 2005 Apr 21;46(2):247-60.
|
|
| MT10661 |
C. elegans |
tdc-1(n3420) II. Show Description
Forages while backing. Deletion in L-aromatic amino acid decarboxylase with homology to histidine decarboxylase. Reference: Alkema M, et al. Neuron. 2005 Apr 21;46(2):247-60.
|
|
| MT1071 |
C. elegans |
egl-21(n476) IV. Show Description
Egl. Fails to complement daf-14 as well; small deletion or background?? [NOTE: The CGC has received reports that n476 might be heterozygous in this strain. KP2018 is an outcrossed version of this strain and has been confirmed as homozygous for n476.].
|
|
| MT11826 |
C. elegans |
sqv-7(n3789)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUncs, and Sqv which are sterile (probably Mel). The bases 17746 to 19294 of the C52E12 cosmid sequence are deleted and 19295 to 19316 are duplicated. The N terminal 239 bases of coding sequence for sqv-7 are left intact; they are predicted to encode 79 amino acids (of 329 amino acids total) of SQV-7 (followed by a frameshift).
|
|
| MT12945 |
C. elegans |
mir-52(n4100) IV. Show Description
Deletion breakpoints are: CTACTCCTACAACTACAACTAC / TACTACTACTATA...ATCACGTTTAAATCA / ATTTCCCAAGAGTTTTCGTATAAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT12954 |
C. elegans |
mir-1(n4101) I. Show Description
Deletion breakpoints are:TAGAGCATGTTGCCAATATTGGCAT / GAAAATATTGGCAA...TCACTTTGAATATAGCG / TAGATATAGAGTAGAATTGAATCTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT12955 |
C. elegans |
mir-1(n4102) I. Show Description
Deletion breakpoints are:CGTCAGAAGGGCGCCTTTTCCTTCG / CCTTGCCGCATCG...CGTCATTGCCGTC / TTAACAGGCATCGAATGGAAAAATTGGCG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT12958 |
C. elegans |
mir-87(n4104) V. Show Description
Deletion breakpoints are:CACACACACACACACATACATA / CATACATACAT...CACACAGCCAAAA / GGGGCGGGACGACGACTCCTCCCCGCCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT12960 |
C. elegans |
epc-1(n4076) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Uncs, Ste/Mel, and dead eggs. The epc-1(n4076) deletion removes 886 nucleotides from the epc-1 locus (Y111B2A.11). Relative to the first nucleotide of the predicted initiator ATG, the deletion begins at about nt. 2014 and ends at about nt. 2899 to give the junction sequence CTTCTCTGT/CCGGCTTTA.
|
|
| MT12963 |
C. elegans |
ssl-1(n4077) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Unc, Ste/Mel, and dead eggs. ssl-1(n4077) deletion removes 683 nucleotides from the ssl-1 locus (Y111B2A.23). Relative to the first nucleotide of the predicted initiator ATG, the deletion begins at about nt. 5075 and ends at about nt. 5757 to give the junction sequence GATATACAC/AGACCTAAT.
|
|
| MT12969 |
C. elegans |
mir-259(n4106) V. Show Description
Deletion breakpoints are: GATTATAATGCAAACAACCTGGGGGATC / CAGTATCTTCA...AAGAGCGAAAGT / ACAGTCTCCTCCTTCTTTGCTCACTTCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT12979 |
C. elegans |
mir-70(n4110) V. Show Description
Deletion breakpoints are:TTTTTTACCGTTGAGTTTCAGAAGT / ATATTTTTTCT...ACGACGTATTA / CATTTCTTCATAAGTGTTATTCGTCGAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT12983 |
C. elegans |
mir-238(n4112) III. Show Description
Deletion breakpoints are: ACAACTTAATATCTTTTCTGGTCATTTTCAA / TACTTACCTCA...AGGTGACAGAAA / GTTGTGTGAAAATGACAAATATCTCTTTTCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT12989 |
C. elegans |
mir-53(n4113) IV. Show Description
Deletion breakpoints are: ACTCTATGATGTCCTTCAAAACAACA / TAATTTACGCCAT...CAGAATCGGGAGAAA / TTTATAATAATAGAGAGAGAGAGA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT12990 |
C. elegans |
mir-52(n4114) IV. Show Description
Deletion breakpoints are: CTTACCCCCCAAACCCTG / CCGCTACTACTACTACTCCTA...GAAAGGGTAGCCGGTTATT / GAAGTTGGGTCTTTTTTGGG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT12993 |
C. elegans |
mir-71(n4115) I. Show Description
Deletion breakpoints are: CGATCCCGACGGCGAAAAACAG / AATAGTGATACGAC...TGTGTGTGAGCTA / GTTTCAACACTGAGGTTTTGTTGGAAAGT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT12999 |
C. elegans |
mir-85(n4117) II. Show Description
Deletion breakpoints are:TCATCTGATGACTTATCTTCA / TACTCGTGT...AACGTGATGAA / GGTCCGGATAGGGCTTGAGCTATTCGTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT13015 |
C. elegans |
mir-72(n4130) II. Show Description
Deletion breakpoints are: CTCTCTGCGGAATTATATCAATTTTCT / ACCAATTCTATA...CAGGTCGAGCACTC / GGACTCCTTCTGTGAAGTGCACCTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT13016 |
C. elegans |
nDf52 III. Show Description
nDf52 removes mir-229 and mir-64. Deletion is 652 bp from -525 to 128 from 5'end of mir-64. Reference: PLos Genet (2007) 3(12):e215.
|
|
| MT13078 |
C. elegans |
mir-73&mir-74(nDf47) X. Show Description
Deletion breakpoints are: GAGAGTCCCACACACGACTGGACTTCCA / TATCGAGCCA...AATGGCAGTCTA / CACGTTTTTCAACCAAATGCTATGGCC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT13113 |
C. elegans |
tdc-1(n3419) II. Show Description
n3419 is a deletion in L-aromatic amino acid decarboxylase with homology to histadine decarboxylase. Forages while backing. PKA adc-1.
|
|
| MT13172 |
C. elegans |
mys-1(n4075) V/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+ and segregate Ste GFP- and dead eggs. The myo-1(n4075) deletion removes 1010 nucleotides from the mys-1 locus (VC5.4). Relative to the first nucleotide of the predicted initiator ATG, the deletion begins at about nt. 106 and ends at about nt. 1115 to give the junction sequence GATGCCGGT/TCTGCGTGGG.
|
|
| MT13292 |
C. elegans |
mir-124(n4255) IV. Show Description
Deletion breakpoints are:GTCGCTCATTGATTCACATCCATTTTGAG / AAGGATGGTT...GAATGCCACGTG / GCCATGATGGGGCTCCCATTGAAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT13293 |
C. elegans |
met-2(n4256) III. Show Description
Deletion of R05D3.11.
|
|
| MT13372 |
C. elegans |
nDf49 II. Show Description
mir-42, mir43 and mir-44 are deleted in nDf49. Deletion breakpoints are:GGAGCTTGCACTTCCAAAAC / CCGACGATCTGAGAAATCC...GCTATGTATCAATCTACG / CGATAGCTAGAAAAAAAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT13406 |
C. elegans |
mir-34(n4276) X. Show Description
Deletion breakpoints are: AACAACAACAAAAACTTTTTTTACC / ATTTAAAAAAATAA...GAATGGGAAAAAAAA / GGAAGCTGTGGCCTGTCGCATAGTTAC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT13433 |
C. elegans |
mir-45(n4280) II. Show Description
Deletion breakpoints are:TCCACCAGCAAAAAGCCGT / CTCCAAAGAAGGCTGCTCCG...AAAAAACTACAAATTCTCG / TTTCCATTACTTTTCAGAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT13516 |
C. elegans |
isw-1(n4066) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n4066 homozygotes (sterile). n4066 is a deletion of F37A4.8.
|
|
| MT13649 |
C. elegans |
nurf-1(n4295) II. Show Description
1077 bp deletion of the 3' end of F26H11.3.
|
|
| MT13650 |
C. elegans |
mir-48(n4097) V. Show Description
Worms are weakly retarded, with cold-sensitive supernumerary adult-stage molt phenotype (<5% at 20C, about 70% at 15C). 293 bp deletion encompassing the mir-48 gene. mir-48 is at 5908 to 5885 of F56A12. Deletion goes from -45 to +248 from start of mir-48.
|
|
| MT13651 |
C. elegans |
mir-84(n4037) X. Show Description
Superficially WT. mir-84 deletion is between 2891 and 3682 of clone B0395. mir-84 is at 3351-3330 in B0395.
|
|
| MT13653 |
C. elegans |
mir-237(n4296) X. Show Description
Deletion breakpoints are:GAAGATCATTCTTAAATCTGTTTAGCA / TTTTGAAAGTTT...ACTGCATTAGAACT / GCAAAAAAAAGTTTCGAGAAAAGTGGCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT13664 |
C. elegans |
nurf-1(n4293)/mnC1 [dpy-10(e128) unc-52(e444)] II; lin-15B&lin-15A(n765) X. Show Description
n4293: F26H11.2 deletion. 724 bp deletion of splice donor of exon 1 and all of exon 2. Heterozygotes are Muv. Segregates Muv, Ste, and Dpy Uncs.
|
|