Search Strains

C. elegans wild isolate. Isolated in Hermanville (Calvados) , France in September, 2002 from a compost pile. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated in Hermanville (Calvados), France. Compost pile. Sept 02. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

C. elegans wild isolate. Isolated in Hermanville (Calvados) , France in September, 2002 from a compost pile. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated in Hermanville (Calvados), France. Compost pile. Sept 02. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

From Hermanville (Calvados), France, from a compost pile, Sept 2002. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Male-female species. Maintain at 20C or warmer. Elegans group. Isolated from rotting flower on upright Musa coccinea plant sampled near Sapa, Vietnam on 30 Nov 2019. GPS 22.33947, 103.86148. Reference: Felix et al., in preparation.

Male-female species. Maintain at 20C or warmer. Elegans group. Isolated from rotting Solanum virginianum fruits sampled near Sapa, Vietnam on 30 Nov 2019. GPS 22.3228, 103.8841. Reference: Felix et al., in preparation.

Male-female species. Maintain at 20C or warmer. Elegans group. Isolated from rotting fruit sampled near Sapa, Vietnam on 30 Nov 2019. GPS 22.32291, 103.88791. Reference: Felix et al., in preparation.

C. elegans wild isolate. Isolated in Hermanville (Calvados) , France on December 30, 2002 from a compost pile. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Male-female species. Maintain at 20C or warmer. Portoensis group. Isolated from rotting Musa coccinea flower on ground, near Sapa, Vietnam on 1 Dec 2019. GPS 22.2898, 103.9337. Freeze with DMSO/Dextran protocol. Reference: Felix et al., in preparation.

Isolated in Hermanville (Calvados), France. Compost pile. Sept 02. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Male-female species. Maintain at 20C or warmer. Elegans group. Isolated from rotting fruits collected near Dalat, Vietnam on 4 Dec 2019. GPS 12.17523, 108.69884. Reference: Felix et al., in preparation.

Male-female species. Maintain at 20C or warmer. Elegans group. Isolated from rotting Solanum virginianum fruits collected in pine forest near Dalat, Vietnam on 4 Dec 2019. GPS 12.1530, 108.6595. Reference: Felix et al., in preparation.

Isolated in Hermanville (Calvados), France. Compost pile. Sept 02. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

From ReykjavIk cemetery (Iceland). Collected on August 10, 2003. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated by Dorothee Baille. Beauchene (Eure & Loir), France, in a compost pile, on September 12, 2003. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

From Beauchêne (Eure & Loir -France), in the cabbage parcel, 12 Sep 03. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated from compost heap in Marsas (Hautes-Pyrénées, France) on August 15, 2004. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated from compost heap in Primel-Trégastel (Finistère, France), 03 Oct 04. Picked as adult on 6 Oct 04. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated from the compost heap in Jean-Antoine Lepesant's garden (Le Perreux sur Marne -94- France), 14 Dec 04. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Male-female strain. Isolated on May 13, 2005 in Zhouzhuang, Jiangsu, China from soil in cultivated fields (beans, cereal) at the SW entrance of the village.

Isolated on May 4, 2005 from mushroom compost in a farmyard 1 km south of Yangshuo, Guangxi, China. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated on May 6, 2005 from soil with freshly added compost in a cabbage field in Chengyang Village, 20 km north of Sanjiang, Guangxi, China. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Male-female strain. Isolated on May 6, 2005 under a tree along a path between two villages in Changyang, 20 km north of Sanjiang, Guangxi, China. Does not cross with C. remanei PB4641 or JU724, nor with C. sp. PB2801. sp. 5 in Kiontke and Sudhaus Wormbook Ecology chapter.

Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated in Le Blanc (12 June 2005), from a compost heap. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated in Carcavelos, Portugal from garden garbage left on pavement, 10 July 05. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated in the Botanical Garden, Lisbon, Portugal. July 10, 2005 below a tree with red fruits rotting. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated in the Botanical Garden, Lisbon, Portugal. July 10, 2005 below a tree with red fruits rotting. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated in the Botanical Garden, Lisbon, Portugal. July 10, 2005 below a tree with red fruits rotting. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated in the Botanical Garden, Lisbon, Portugal. July 10, 2005 below a Ficus isophlebia tree with fruit. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated in the Botanical Garden, Lisbon, Portugal. July 10, 2005 below a Ficus isophlebia tree with fruit. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated in the Botanical Garden, Lisbon, Portugal. July 10, 2005 below a Ficus isophlebia tree with fruit. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated in the Botanical Garden, Lisbon, Portugal. July 10, 2005 below a Ficus isophlebia tree with fruit. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated from the compost heap at the top of the garden in Frechendets (Hautes Pyrénées), on August 31, 2005. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated in the Botanical Garden, Lisbon, Portugal. July 10, 2005 below a tree with red fruits rotting. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Male-female strain. Inbred derivative of JU727. Derived from JU727 by 20 generations of sib mating. Male/female strain. Isolated on May 6, 2005 under a tree along a path between two villages in Changyang, 20 km north of Sanjiang, Guangxi, China. Does not cross with C. remanei PB4641 or JU724, nor with C. sp. PB2801. sp. 5 in Kiontke and Sudhaus Wormbook Ecology chapter.

Compost heap of Ray Hong in Tübingen, Germany, 28 Sep 05. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated from a vegetable garden/orchard near Obernai (Bas-Rhin), France on October 2, 2005. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Sampled in a compost heap in vegetable gardens/vineyards (Bas-Rhin), France on 3 Oct 05 by MAF. Plated 4 Oct, picked as L4 on 4 Oct 05. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

lkIs1 [elp-1::GFP + lin-15(+)] II. Relatively low levels of GFP expression as compared to KA42. Superficially wild-type. Maintain under normal conditions. Reference: Hueston JL, et al. BMC Dev Biol. 2008 Nov 17;8:110.

lkIs2 [elp-1::GFP + lin-15(+)] IV. Relatively high levels of GFP expression as compared to KA41. Superficially wild-type. Maintain under normal conditions. Reference: Hueston JL, et al. BMC Dev Biol. 2008 Nov 17;8:110.

lkEx1 [elp-1::GFP + lin-15(+)]. Animals carrying the aray are superficially wild-type. Pick wild-type to maintain. Maintain under normal conditions. Reference: Hueston JL, et al. BMC Dev Biol. 2008 Nov 17;8:110.

Pick GFP+ to maintain balanced stock. Heterozygotes are superficially wild-type GFP+ and segregate wild-type GFP+ (heterozygotes), arrested hT2 aneuploids, and non-GFP glh-4 glh-1 homozygotes (sterile; incompletely penetrant). NOTE (K. Bennett, 2012): KB4 strain is only 63% sterile at 20C and 92% sterile at 26C (Spike et al., Genetics 2008 178:1973). glh-1(ok439) is not a null allele.

Deletion alleles. Can be maintained at 20C. Sterile at 26C. Can use PCR with the following primer to determine whether both deletions are present. (5'end)5'GGTCTACCAGAGTTTGTGCGCAATC3' (3'end)5'GATAGCCTTGCACTTCGTTG3'. PCR products from wild type show two bands; kgb-1 gene shows a smaller band; kgb-2 gene shows a bigger band.The double mutant should have no PCR product. [NOTE: The 5' primer sequence was corrected 03/28/12 (K. Bennett)]