More Fields
Strain Species Genotype
EW34 C. elegans egl-18(ga97) IV. Show Description
Egl. Rol.
GLW35 C. elegans T13C2.6(utx27[mNG::3xFlag::T13C2.6]) II. Show Description
N-terminal tag of T13C2.6 via CRISPR/Cas9 knock-in of mNeonGreen at T13C2.6 locus. Insertion verified by PCR and fluorescence. Left flank: 5' aaatattaattgataatcagaggagtaaaa 3'; Right flank: 5' ATGAGGACATGTCTCACCCTCACGGGTTTC 3'; sgRNA: taatcagaggagtaaaaATG; Cas9/sgRNA plasmid: pGLOW45; mNG^SEC^3xFlag plasmid: pGLOW54; SEC insertion allele strain: GLW34.
IX3447 C. elegans kyIs140 I; vyEx1462. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. vyEx1462 (die-1(fosmid)::Venus + odr-1::DsRed + ofm-1::DsRed). Pick animals with DsRed+ coelomocytes to maintain. Animals with vyEx1462 show 2AWC(OFF) phenotype. Extrachromosomal array rescues die-1(w34).
JR1380 C. elegans die-1(w34)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are wild type and segregate wild type, paralyzed Dpys, and die-1 homozygous embryos.
RW3455 C. elegans stDf4/act-3(st22) V. Show Description
Heterozygotes are slow moving and fertile. stDf4 homozygotes move well and are sterile. st22 homozygotes are small and very sick. Pick slow moving animals and avoid well moving fertile recombinants.