Search Strains

rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. Rollers, red fluorescence in vulvae. YFP cannot be detected. Maintain at 20C. Reference: Ou G, et al. Science. 2010 Oct 29;330(6004):677-80.

rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Rollers, red fluorescence in vulvae. YFP cannot be detected. Maintain at 20C. Reference: Ou G, et al. Science. 2010 Oct 29;330(6004):677-80.

rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. ddIs6 [pie-1p::GFP::tbg-1 + unc-119(+)] V. Rollers, red fluorescence in vulvae. YFP cannot be detected. Maintain at 20C. Reference: Ou G, et al. Science. 2010 Oct 29;330(6004):677-80.

tmIs1243 [myo-2p::mCherry, X: ubc-17] X. Homozygous lethal. Deletion of 2153 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, arrested GFP+ non-mCherry (ve548 homozygotes), and Lon Mec non-GFP mCherry+ (tmC30 homozygotes). Maintain by picking wild-type GFP+ mCherry+. Left flanking Sequence: TTTGACTTGTTTGTACCCGCATCTACATTG ; Right flanking sequence: ATCGGGAGTTTCTGCACACTGAGTTCATTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

tmIs1243 [myo-2p::mCherry, X: ubc-17] X. Homozygous animals may be sensitive to starvation (grotty, low brood size). Deletion of 1634 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, wild-type GFP+ non-mCherry (ve808 homozygotes), and Lon Mec non-GFP mCherry+ (tmC30 homozygotes). Maintain by picking wild-type GFP+ mCherry+. Left flanking Sequence: TACTATATTCTGTTATTCCAAAATGCGTTT ; Right flanking sequence: ATAATGTGAACAGCACGCAAAACGGAACAA. sgRNA #1: GTTCCAGATGACAACAGACT; sgRNA #2: TGTCAAATCAGCTTTTTCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

tmIs1266 [myo-2p::mCherry, II: lin-42] II. Homozygous larval arrest. Deletion of 1509 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, GFP+  arrested larvae (ve828 homozygotes) and mCherry+ animals [lin-42(tmIs1226) homozygotes]. Maintain by picking wild-type GFP+ mCherry+. Note: recombination is possible and should be evident by the presence of non-fluorescent animals that are neither GFP+ nor mCherry+. Note from parent strain FX30266: Egl phenotype of lin-42 is not detectable. Left flanking Sequence: CAAAAACTGATTTTTCTGAAATCTAGTCCG; Right flanking sequence: GAGTACACGAGATATCCTGGAAAATTAGAT. nsun-1 sgRNA #1: ATGACGGTTTCAATACGGTA; nsun-1 sgRNA #2: CACGTGCTCTGTACTCGTCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

tmIs1208 [myo-2p::mCherry, II: dpy-2] II. Embryonic lethal. Deletion of 3081 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, GFP+ non-mCherry dead eggs (ve832 homozygotes) and Dpy non-GFP mCherry+ (tmC6 homozygotes). Maintain by picking wild-type GFP+ mCherry+.  Left flanking Sequence: GTGGGGAAAGATGCTAGACGGCTAGCTCCT; Right flanking sequence: AGGTCGTGGCGATCTTTGCAGGATTTGCTG. skpo-2 sgRNA #1: GGACTACAATGCCTGGAAAG; skpo-2 sgRNA #2: TCGAGGACCAGAATTTACAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

tmIs1208 [myo-2p::mCherry, II: dpy-2] II. Sterile. Deletion of 7616 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, GFP+ non-mCherry sterile adults (ve1005 homozygotes) and Dpy non-GFP mCherry+ (tmC6 homozygotes). Maintain by picking wild-type GFP+ mCherry+.  Note: tsr-1 is near ZK1240.1, the gene marking the breakpoint of the tmC6 balancer. Left flanking Sequence: aaatTTAGATGAACAGCTTGGCGAGATCAC; Right flanking sequence: tagtgagctctagttttcggtgtctaggct. tsr-1 crRNA A: GAGTATGGTTGAAGACGGCG; tsr-1 crRNA B: gctcaattttgaagtctcgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

atrIs1 [ftt-2p::ftt-2::mCherry + unc-119(+)]. Line is slightly sick and burrows. FTT-2::mCherry fusion protein rescues ftt-2(tm1486) deletion mutant. Reference: Linden LM, et al. Dev Biol. 2017 Sep 1;429(1):271-284. PMID: 28648843

mdEx865 [unc-17p::NLS::mCherry + pha-1(+)]. Transcriptional reporter. Nuclear localized mCherry in cholinergic neurons. Maintain at 20-25C to retain array. References: Grundahl K and Rand J, unpublished. Granato M, Schnabel H, and Schnabel R, 1994. Genesis of an organ: molecular analysis of the pha-1 gene. Development 120: 3005–3017.

trEx1001 [idpb-3p::idpb-3::mNeonGreen + myo-2p::mCherry]. Pick animals with mCherry+ pharynx to maintain. Generated in N2 background. Reference: Kamal M, et al. bioRxiv 2022.03.11.483951; doi: https://doi.org/10.1101/2022.03.11.483951.

trEx1010 [pgp-14p::sms-5B(genomic)::Flag::mCherry + pgp-14p::YFP::pgp-14]. Pick animals with mCherry+ pharynx to maintain. Fluorescence is more apparent in older animals (late stage larvae to young adults). Generated in N2 background. Reference: Kamal M, et al. bioRxiv 2022.03.11.483951; doi: https://doi.org/10.1101/2022.03.11.483951.

trEx1006 [fipr-4p::fipr-4::mNeonGreen + myo-2p::mCherry]. Pick animals with mCherry+ pharynx to maintain. Generated in N2 background. Reference: Kamal M, et al. bioRxiv 2022.03.11.483951; doi: https://doi.org/10.1101/2022.03.11.483951.

trEx1008 [idpa-3p::idpa-3::mNeonGreen + myo-2p::mCherry]. Pick animals with mCherry+ pharynx to maintain. Generated in N2 background. Reference: Kamal M, et al. bioRxiv 2022.03.11.483951; doi: https://doi.org/10.1101/2022.03.11.483951.

GFP tag inserted in endogenous unc-94 locus; specifically tags UNC-94A isoform. Green fluorescence is visible by compound microscopy as striations in body wall muscles, as elongated puncta in single-sarcomere (anal depressor, uterine, and vulval) muscles, as well as the cell bodies of two neurons. Not visible on fluorescent dissection microscopes. Modifcation of the endogenous myo-3 loci by the insertion of a trans-splicing ICR region and worm-optimized mCherry at region encoding the head-neck junction. Bright red fluorescence is visible as striations in body wall muscles and clusters in single-sarcomere (anal depressor, vuvla, uterine) muscles. Please contact Ryan Littlefield prior to publishing work using this strain.

Endogenous deb-1 locus tagged with mCherry. Bright red fluorescence in all muscles is visible by dissection fluorescence microscopy. Please contact Ryan Littlefield prior to publishing work with this strain.

unc-54(ftw19[NLS::mCherry::SL2::GFP::unc-54]) I. myo-3(ftw16[NLS::GFP::SL2::mCherry::myo-3]) V. Endogenous unc-54 locus tagged with NLS::GFP and mCherry using CRISPR/Cas9; coexpressed from the endogenous promoter using trans-splicing. Body muscles have bright green fluorescence within myofibrils and bright red nuclei visible by dissection fluorescence microscopy. Slow movement and slightly impaired egg-laying. Endogenous myo-3 locus tagged with NLS::GFP and mCherry using CRISPR/Cas9; coexpressed from the endogenous promoter using trans-splicing. Please contact Ryan Littlefield prior to publishing work using this strain.

Endogenous tni-3 locus tagged with mCherry using CRISPR/Cas9. GFP-nls coexpressed from the endogenous promoter using SL2 trans-splicing. Visible using fluorescent dissecting microscopes. WT movement and behavior. Please contact Ryan Littlefield prior to publishing work using this strain.

GFP tag inserted in endogenous unc-94 locus; specifically tags UNC-94A isoform. mCherry tag inserted into endogenous tni-3 locus; GFP::NLS coexpressed from the endogenous tni-3 promoter via SL2 trans-splicing. GFP::UNC-94 is visible by compound microscopy as striations in body wall muscles, as elongated puncta in single-sarcomere (anal depressor, uterine, and vulval) muscles, as well as the cell bodies of two neurons. GFP::UNC-94 is not visible on fluorescent dissection microscopes. Please contact Ryan Littlefield prior to publishing work using this strain.

Endogenous myo-3 locus tagged with mCherry using CRISPR/Cas9. nls-GFP coexpressed from the endogenous promoter using trans-splicing. Visible using fluorescent dissecting microscopes. WT movement and behavior. Please contact Ryan Littlefield prior to publishing work using this strain.

GFP tag inserted in endogenous unc-94 locus; specifically tags UNC-94A isoform. mCherry tag inserted into endogenous myo-3 locus; GFP::NLS coexpressed from the endogenous myo-3 promoter via SL2 trans-splicing. GFP::UNC-94 is visible by compound microscopy as striations in body wall muscles, as elongated puncta in single-sarcomere (anal depressor, uterine, and vulval) muscles, as well as the cell bodies of two neurons. GFP::UNC-94 is not visible on fluorescent dissection microscopes. Please contact Ryan Littlefield prior to publishing work using this strain.

Endogenous locus tagged with GFP using CRISPR/Cas9. NLS-mCherry co-expressed from the endogenous promoter using trans-splicing. Body muscles have bright green fluorescence within myofibrils and bright red nuclei visible by dissection fluorescence microscopy. Slow movement and slightly impaired egg-laying. Please contact Ryan Littlefield prior to publishing work using this strain.

Modifcation of the endogenous myo-3 loci by the insertion of a trans-splicing ICR region and worm-optimized mCherry at region encoding the head-neck junction. Bright red fluorescence is visible as striations in body wall muscles and clusters in single-sarcomere (anal depressor, vuvla, uterine) muscles. Worms are phenotypically wildtype. Please contact Ryan Littlefield prior to publishing work using this strain.

GFP tag inserted into endogenous pat-3 locus; mCherry coexpressed from the endogenous pat-3 promoter via SL2 trans-splicing. mCherry tag inserted into endogenous pat-2 locus; GFP::NLS coexpressed from the endogenous pat-2 promoter via SL2 trans-splicing. Please contact Ryan Littlefield prior to publishing work using this strain.

Endogenous locus tagged with mCherry using CRISPR/Cas9. Pharynx muscle is visibly red by dissection fluorescence microscopy. WT pumping and behavior. Please contact Ryan Littlefield prior to publishing work using this strain.

ftwEx1 [mlc-2p::GFP::SL2::mCherry::mlc-2]. Pick GFP+ to maintain. Extrachromosomal array expressing GFP and mCherry in muscles. Pharynx and bodywall muscles are visibly bright green by dissection fluorescence microscopy. WT movement and behavior. Please contact Ryan Littlefield prior to publishing work using this strain.

pwIs403 [pie-1p::mCherry::rab-5 + unc-119(+)]. mCherry::RAB-5 provides a marker of early endosomes in the germline and in early embryos. Superficially wild-type. For best expression maintain propagate at 25 degrees.

zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10044 [mir-57::HIS-24::mCherry + unc-119(+)].

stIs10055 [cnd-1(3.2kb)::HIS-24::mCherry + unc-119(+)].

zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10060 [cnd-1(3.2kb)::HIS-24::mCherry + unc-119(+)].

zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10050 [pha-4(4kb)::HIS-24::mCherry + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.

zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10059 [cnd-1(3.2kb)::HIS-24::mCherry + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.

zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10088 [hlh-1(3.3kb)::HIS-24::mCherry + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.

stIs10026 [his-72(1kb)::HIS-72::GFP + unc-119(+)]. stIs10089 [hlh-1(3.3kb)::HIS-24::mCherry + unc-119(+)].

zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10177 [cwn-1::H1-wCherry::his-24::mCherry + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3'UTR + unc-119(+)] in the background.

Ubiquitous histone-cherry expression suitable for lineage analysis. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10226 [his-72p::HIS-24::mCherry::let-858 3' UTR + unc-119(+)]. Translational HIS-24::mCherry fusion. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

stIs10305 [hmp-2p::HIS-24::mCherry + unc-119(+)].

stIs10338 [kin-33p::HIS-24::mCherry + unc-119(+)].

zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10322 [ceh-43::H1-wCherry::his-24::mCherry + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3'UTR + unc-119(+)] in the background.

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10318 [nhr-25::TGF(3H4)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10311 [lin-39::TGF(3D3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10309 [mab-5::TY1::eGFP::3xFLAG(P000007_E01)]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10389 [pha-4::TGF(3E3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10400 [C01B7.1::H1-wCherry::his-24::mCherry + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.

zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10433 [dsl-1::H1-wCherry::his-24::mCherry + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10394 [cnd-1::TGF(3C3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10426 [med-2::TGF(6.2B3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10436 [hlh-1::TGF(6.2B4)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10472 [lin-11::TGF(7H3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10440 [ceh-27::H1-wCherry::his-24::mCherry + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.